Mutants (Isolated)

tm546

Allele Nametm546
Sequence NameT24D1.1a
CGC Namesqv-5
Worm BaseAllele Name tm546
CGC Name sqv-5
Sequence T24D1.1a
Phenotypelethal or sterile, Dr. K. Nomura: Nature 423, 443-448 (2003)
Mutation site6741/6742-7301/7302 (560 bp deletion)
ChromosomeI
Putative gene structurejoin(4858..4866, 5748..6035, 6094..6425, 6866..7349, 7598..8025, 8226..8571, 8622..8699, 9213..9395)
Map position4.09
Balancerunc-55 (e402) I
Map position of balancer2.34
Sequence of primersIntRev:TGTTGTTCTGTTTGGTGGAC,IntFwd:GCCACCGTCACAATCCTACT,ExtFwd:CAGCGGAGCACATGCAGAAT,ExtRev:TGTTGAACATACGCGTGTCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Mizuguchi S, Uyama T, Kitagawa H, Nomura KH, Dejima K, Gengyo-Ando K, Mitani S, Sugahara K, Nomura K.
Chondroitin proteoglycans are involved in cell division of Caenorhabditis elegans.
Nature 2003 423(6938) 443-8 
[ PubMed ID = 12761550 ] [ RRC reference ]