Mutants (Isolated)

tm5454

Allele Nametm5454
BalanceNot Required
OutCrossNot Accepted
Sequence NameC16A3.10
Gene NameC16A3.10
Worm BaseAllele Name tm5454
Gene Name C16A3.10
Sequence C16A3.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 27671/27672-28065/28066 (394 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(26384..26556, 26606..26744, 26798..26990, 27043..27356, 27438..27452, 27694..27933))
Map position-1.3
Balancer
Map position of balancer
Sequence of primersExtRev:TAGCGGAGCATCACGTTGGA,IntRev:TCTGTCCCGGCTACATGCCA,ExtFwd:CTCCTGGCTTGATGTTCATC,IntFwd:GCACTGCAGAAACTGGGTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bailly AP, Perrin A, Serrano-Macia M, Maghames C, Leidecker O, Trauchessec H, Martinez-Chantar ML, Gartner A, Xirodimas DP.
The Balance between Mono- and NEDD8-Chains Controlled by NEDP1 upon DNA Damage Is a Regulatory Module of the HSP70 ATPase Activity.
Cell Rep 2019 29(1) 212-224.e8 
[ PubMed ID = 31577950 ] [ RRC reference ]