Mutants (Isolated)

tm545

Allele Nametm545
BalanceNot Required
OutCrossNot Accepted
Sequence NameY66H1B.3
Gene Namefln-1
Worm BaseAllele Name tm545
Gene Name fln-1
Sequence Y66H1B.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. D. Greenstein: low brood size at 20C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26266/26267-TCAGTAAAATTTGAATA-26529/26530 (263 bp deletion + 17 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(21251..21978, 22294..22393, 22461..23015, 23696..24231, 24532..24808, 24850..25412, 25459..25632, 26482..26653, 26702..26815, 26865..26900))
Map position-26.37
Balancer
Map position of balancer
Sequence of primersExtRev:GTTTTCAGTGTATGGGAGCT,IntFwd:GCCACAGTTGGTGTATAGGA,ExtFwd:CCCAACTTTGTAAACTCCAG,IntRev:GGAGTTCCCCTTTCCTCTAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kelley CA, Triplett O, Mallick S, Burkewitz K, Mair WB, Cram EJ.
FLN-1/filamin is required to anchor the actomyosin cytoskeleton and for global organization of sub-cellular organelles in a contractile tissue.
Cytoskeleton (Hoboken) 2020 77(10) 379-398 
[ PubMed ID = 32969593 ] [ RRC reference ]

Choi S, Ambros V.
The C. elegans heterochronic gene lin-28 coordinates the timing of hypodermal and somatic gonadal programs for hermaphrodite reproductive system morphogenesis.
Development 2019 146(5)  
[ PubMed ID = 30745431 ] [ RRC reference ]

Nakamura F, Kumeta K, Hida T, Isono T, Nakayama Y, Kuramata-Matsuoka E, Yamashita N, Uchida Y, Ogura K, Gengyo-Ando K, Mitani S, Ogino T, Goshima Y.
Amino- and carboxyl-terminal domains of Filamin-A interact with CRMP1 to mediate Sema3A signalling.
Nat Commun 2014 5 5325 
[ PubMed ID = 25358863 ] [ RRC reference ]

Kovacevic I, Orozco JM, Cram EJ.
Filamin and phospholipase C-ε are required for calcium signaling in the Caenorhabditis elegans spermatheca.
PLoS Genet 2013 9(5) e1003510 
[ PubMed ID = 23671426 ] [ RRC reference ]

Kovacevic I, Cram EJ.
FLN-1/filamin is required for maintenance of actin and exit of fertilized oocytes from the spermatheca in C. elegans.
Dev Biol 2010 347(2) 247-57 
[ PubMed ID = 20707996 ] [ RRC reference ]