Mutants (Isolated)

tm544

Allele Nametm544
Sequence NameC06A1.1
CGC Namecdc-48.1
Worm BaseAllele Name tm544
CGC Name cdc-48.1
Sequence C06A1.1
Phenotypehomozygous viable. Dr. T. Ogura: BBRC 345, 746-753 (2006). Genes to Cells: 12, 1063 (2007). Dr. T. Hoppe: J. Struct. Biol. 156, 41 (2006), Nat. Cell Biol. 9, 379 (2007).
Mutation site3193/3194-3861/3862 (668 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(1127..1262,1312..1506,1762..2834, 2881..3708,3987..4184))
Map position3.11
Balancer
Map position of balancer
Sequence of primersIntRev:CCAACGCATCAAAGCGAAAA,ExtRev:ACATAATGGCCTCGGTTCCA,ExtFwd:CATCGAAGAACAACACGCAA,IntFwd:CACGAGCCTTGTCGAAGACA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Cheung TP, Choe JY, Richmond JE, Kim H.
BK channel density is regulated by endoplasmic reticulum associated degradation and influenced by the SKN-1A/NRF1 transcription factor.
PLoS Genet 2020 16(6) e1008829 
[ PubMed ID = 32502151 ] [ RRC reference ]

Herzog LK, Kevei É, Marchante R, Böttcher C, Bindesbøll C, Lystad AH, Pfeiffer A, Gierisch ME, Salomons FA, Simonsen A, Hoppe T, Dantuma NP.
The Machado-Joseph disease deubiquitylase ataxin-3 interacts with LC3C/GABARAP and promotes autophagy.
Aging Cell 2020 19(1) e13051 
[ PubMed ID = 31625269 ] [ RRC reference ]

Franz A, Pirson PA, Pilger D, Halder S, Achuthankutty D, Kashkar H, Ramadan K, Hoppe T.
Chromatin-associated degradation is defined by UBXN-3/FAF1 to safeguard DNA replication fork progression.
Nat Commun 2016 7 10612 
[ PubMed ID = 26842564 ] [ RRC reference ]

Martínez-Velázquez LA, Ringstad N.
Antagonistic regulation of trafficking to Caenorhabditis elegans sensory cilia by a Retinal Degeneration 3 homolog and retromer.
Proc Natl Acad Sci U S A 2018 115(3) E438-E447 
[ PubMed ID = 29282322 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Saito-Sasagawa Y, Ogura T.
Caenorhabditis elegans UBX cofactors for CDC-48/p97 control spermatogenesis.
Genes Cells 2010 15(12) 1201-15 
[ PubMed ID = 20977550 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat Cell Biol 2011 13(3) 273-81 
[ PubMed ID = 21317884 ] [ RRC reference ]

Segref A, Torres S, Hoppe T.
A screenable in vivo assay to study proteostasis networks in Caenorhabditis elegans.
Genetics 2011 187(4) 1235-40 
[ PubMed ID = 21288877 ] [ RRC reference ]

Sasagawa Y, Higashitani A, Urano T, Ogura T, Yamanaka K.
CDC-48/p97 is required for proper meiotic chromosome segregation via controlling AIR-2/Aurora B kinase localization in Caenorhabditis elegans.
J Struct Biol 2012 179(2) 104-11 
[ PubMed ID = 22735043 ] [ RRC reference ]

McMullen PD, Aprison EZ, Winter PB, Amaral LA, Morimoto RI, Ruvinsky I.
Macro-level modeling of the response of C. elegans reproduction to chronic heat stress.
PLoS Comput Biol 2012 8(1) e1002338 
[ PubMed ID = 22291584 ] [ RRC reference ]

Liu G, Rogers J, Murphy CT, Rongo C.
EGF signalling activates the ubiquitin proteasome system to modulate C. elegans lifespan.
EMBO J 2011 30(15) 2990-3003 
[ PubMed ID = 21673654 ] [ RRC reference ]

Franz A, Orth M, Pirson PA, Sonneville R, Blow JJ, Gartner A, Stemmann O, Hoppe T.
CDC-48/p97 coordinates CDT-1 degradation with GINS chromatin dissociation to ensure faithful DNA replication.
Mol Cell 2011 44(1) 85-96 
[ PubMed ID = 21981920 ] [ RRC reference ]

Zou CG, Ma YC, Dai LL, Zhang KQ.
Autophagy protects C. elegans against necrosis during Pseudomonas aeruginosa infection.
Proc Natl Acad Sci U S A 2014 111(34) 12480-5 
[ PubMed ID = 25114220 ] [ RRC reference ]

Segref A, Kevei É, Pokrzywa W, Schmeisser K, Mansfeld J, Livnat-Levanon N, Ensenauer R, Glickman MH, Ristow M, Hoppe T.
Pathogenesis of human mitochondrial diseases is modulated by reduced activity of the ubiquitin/proteasome system.
Cell Metab 2014 19(4) 642-52 
[ PubMed ID = 24703696 ] [ RRC reference ]

Murayama Y, Ogura T, Yamanaka K.
Characterization of C-terminal adaptors, UFD-2 and UFD-3, of CDC-48 on the polyglutamine aggregation in C. elegans.
Biochem Biophys Res Commun 2015 459(1) 154-60 
[ PubMed ID = 25721663 ] [ RRC reference ]

Marza E, Taouji S, Barroso K, Raymond AA, Guignard L, Bonneu M, Pallares-Lupon N, Dupuy JW, Fernandez-Zapico ME, Rosenbaum J, Palladino F, Dupuy D, Chevet E.
Genome-wide screen identifies a novel p97/CDC-48-dependent pathway regulating ER-stress-induced gene transcription.
EMBO Rep 2015 16(3) 332-40 
[ PubMed ID = 25652260 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J Neurosci 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]

Sasagawa Y, Otani M, Higashitani N, Higashitani A, Sato K, Ogura T, Yamanaka K.
Caenorhabditis elegans p97 controls germline-specific sex determination by controlling the TRA-1 level in a CUL-2-dependent manner.
J Cell Sci 2009 122(Pt 20) 3663-72 
[ PubMed ID = 19773360 ] [ RRC reference ]

Arur S, Ohmachi M, Nayak S, Hayes M, Miranda A, Hay A, Golden A, Schedl T.
Multiple ERK substrates execute single biological processes in Caenorhabditis elegans germ-line development.
Proc Natl Acad Sci U S A 2009 106(12) 4776-81 
[ PubMed ID = 19264959 ] [ RRC reference ]

Rodrigues AJ, Neves-Carvalho A, Ferro A, Rokka A, Corthals G, Logarinho E, Maciel P.
ATX-3, CDC-48 and UBXN-5: a new trimolecular complex in Caenorhabditis elegans.
Biochem Biophys Res Commun 2009 386(4) 575-81 
[ PubMed ID = 19545544 ] [ RRC reference ]

Caruso ME, Jenna S, Bouchecareilh M, Baillie DL, Boismenu D, Halawani D, Latterich M, Chevet E.
GTPase-mediated regulation of the unfolded protein response in Caenorhabditis elegans is dependent on the AAA+ ATPase CDC-48.
Mol Cell Biol 2008 28(13) 4261-74 
[ PubMed ID = 18458060 ] [ RRC reference ]