分離済み変異体

tm543

Allele Nametm543
Allele Type通常株
Sequence NameF42G9.9
Gene Nameptl-1
Worm BaseAllele Name tm543
Gene Name ptl-1
Sequence F42G9.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Suzuki: mild decrease of chemotaxis to NaCl.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14088/14089-14876/14877 (788 bp deletion)
ChromosomeIII
Putative gene structurejoin(14080..14253,14448..14696,14781..15086)
Map position-26.23
Balancer
Map position of balancer
Sequence of primersExtFwd:TGATCCATCCCGATTTCGGT,IntRev:GTCGACACGTAGCGGATTTT,IntFwd:GGTTTGTCGGTGTGAATTGT,ExtRev:AGCGTAGAATGATTCCGGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705 
[ PubMed ID = 38239833 ] [ RRC reference ]

Osborne JF, Yanagi KS, Hart AC.
Genetic interactions in a C. elegans sod-1 ALS model: glutamatergic neuron degeneration.
MicroPubl Biol 2021 2021  
[ PubMed ID = 33474528 ] [ RRC reference ]

Chew YL, Fan X, Götz J, Nicholas HR.
Aging in the nervous system of Caenorhabditis elegans.
Commun Integr Biol 2013 6(5) e25288 
[ PubMed ID = 24255742 ] [ RRC reference ]

Chew YL, Götz J, Nicholas HR.
Neuronal protein with tau-like repeats (PTL-1) regulates intestinal SKN-1 nuclear accumulation in response to oxidative stress.
Aging Cell 2015 14(1) 148-51 
[ PubMed ID = 25399685 ] [ RRC reference ]

Chew YL, Fan X, Götz J, Nicholas HR.
Regulation of age-related structural integrity in neurons by protein with tau-like repeats (PTL-1) is cell autonomous.
Sci Rep 2014 4 5185 
[ PubMed ID = 24898126 ] [ RRC reference ]

Chege PM, McColl G.
Caenorhabditis elegans: a model to investigate oxidative stress and metal dyshomeostasis in Parkinson's disease.
Front Aging Neurosci 2014 6 89 
[ PubMed ID = 24904406 ] [ RRC reference ]

Chew YL, Fan X, Götz J, Nicholas HR.
PTL-1 regulates neuronal integrity and lifespan in C. elegans.
J Cell Sci 2013 126(Pt 9) 2079-91 
[ PubMed ID = 23525010 ] [ RRC reference ]