Mutants (Isolated)

tm543

Allele Nametm543
Sequence NameF42G9.9
CGC Nameptl-1
Worm BaseAllele Name tm543
CGC Name ptl-1
Sequence F42G9.9
Phenotypehomozygous viable. Dr. H. Suzuki: mild decrease of chemotaxis to NaCl.
Mutation site14088/14089-14876/14877 (788 bp deletion)
ChromosomeIII
Putative gene structurejoin(14080..14253,14448..14696,14781..15086)
Map position-26.23
Balancer
Map position of balancer
Sequence of primersExtFwd:TGATCCATCCCGATTTCGGT,IntRev:GTCGACACGTAGCGGATTTT,IntFwd:GGTTTGTCGGTGTGAATTGT,ExtRev:AGCGTAGAATGATTCCGGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Chew YL, Fan X, Götz J, Nicholas HR.
Aging in the nervous system of Caenorhabditis elegans.
Commun Integr Biol 2013 6(5) e25288 
[ PubMed ID = 24255742 ] [ RRC reference ]

Chew YL, Götz J, Nicholas HR.
Neuronal protein with tau-like repeats (PTL-1) regulates intestinal SKN-1 nuclear accumulation in response to oxidative stress.
Aging Cell 2015 14(1) 148-51 
[ PubMed ID = 25399685 ] [ RRC reference ]

Chew YL, Fan X, Götz J, Nicholas HR.
Regulation of age-related structural integrity in neurons by protein with tau-like repeats (PTL-1) is cell autonomous.
Sci Rep 2014 4 5185 
[ PubMed ID = 24898126 ] [ RRC reference ]

Chege PM, McColl G.
Caenorhabditis elegans: a model to investigate oxidative stress and metal dyshomeostasis in Parkinson's disease.
Front Aging Neurosci 2014 6 89 
[ PubMed ID = 24904406 ] [ RRC reference ]

Chew YL, Fan X, Götz J, Nicholas HR.
PTL-1 regulates neuronal integrity and lifespan in C. elegans.
J Cell Sci 2013 126(Pt 9) 2079-91 
[ PubMed ID = 23525010 ] [ RRC reference ]