| Allele Name | tm543 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F42G9.9 |
| Gene Name | ptl-1 |
| Worm Base | Allele Name |
tm543
|
| Gene Name |
ptl-1
|
| Sequence |
F42G9.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. H. Suzuki: mild decrease of chemotaxis to NaCl. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 14088/14089-14876/14877 (788 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(14080..14253,14448..14696,14781..15086) |
| Map position | -26.23 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TGATCCATCCCGATTTCGGT,IntRev:GTCGACACGTAGCGGATTTT,IntFwd:GGTTTGTCGGTGTGAATTGT,ExtRev:AGCGTAGAATGATTCCGGCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Eck RJ, Stair JG, Kraemer BC, Liachko NF. Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Front Neurosci 2023 17 1300705
[ PubMed ID = 38239833 ]
[ RRC reference ]
|
Osborne JF, Yanagi KS, Hart AC. Genetic interactions in a C. elegans sod-1 ALS model: glutamatergic neuron degeneration. MicroPubl Biol 2021 2021
[ PubMed ID = 33474528 ]
[ RRC reference ]
|
Chew YL, Götz J, Nicholas HR. Neuronal protein with tau-like repeats (PTL-1) regulates intestinal SKN-1 nuclear accumulation in response to oxidative stress. Aging Cell 2015 14(1) 148-51
[ PubMed ID = 25399685 ]
[ RRC reference ]
|
Chew YL, Fan X, Götz J, Nicholas HR. Regulation of age-related structural integrity in neurons by protein with tau-like repeats (PTL-1) is cell autonomous. Sci Rep 2014 4 5185
[ PubMed ID = 24898126 ]
[ RRC reference ]
|
Chege PM, McColl G. Caenorhabditis elegans: a model to investigate oxidative stress and metal dyshomeostasis in Parkinson's disease. Front Aging Neurosci 2014 6 89
[ PubMed ID = 24904406 ]
[ RRC reference ]
|
Chew YL, Fan X, Götz J, Nicholas HR. Aging in the nervous system of Caenorhabditis elegans. Commun Integr Biol 2013 6(5) e25288
[ PubMed ID = 24255742 ]
[ RRC reference ]
|
Chew YL, Fan X, Götz J, Nicholas HR. PTL-1 regulates neuronal integrity and lifespan in C. elegans. J Cell Sci 2013 126(Pt 9) 2079-91
[ PubMed ID = 23525010 ]
[ RRC reference ]
|
|