Mutants (Isolated)

tm5382

Allele Nametm5382
BalanceNot Required
OutCrossNot Accepted
Sequence NameD2030.1
Gene NameD2030.1
Worm BaseAllele Name tm5382
Gene Name D2030.1
Sequence D2030.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4078/4079-TCTTCG-4348/4349 (270 bp deletion + 6 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(3060..3248, 3600..3793, 3842..4183, 4237..4630, 4739..5087, 5132..5286))
Map position2.15
Balancer
Map position of balancer
Sequence of primersIntRev:GGCCTCCGATCACACGAACA,IntFwd:CCACCGGAAAAGCATGCAAG,ExtRev:ATTACGGCAGCAATGGGCCT,ExtFwd:GCGTACGATTCATGACATGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]