Mutants (Isolated)

tm536

Allele Nametm536
Sequence NameR09F10.9
CGC Nameced-13
Worm BaseAllele Name tm536
CGC Name ced-13
Sequence R09F10.9
Phenotypehomozygous viable. Dr. R.H. Horvitz: No extra cells in anterior pharynx. Dr. S. Shaham: Cell Death, Diff., 12, 153-161, (2005).
Mutation site4511/4512-5034/5035 (523 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(4496..4677, 4729..4843))
Map position-0.19
Balancer
Map position of balancer
Sequence of primersExtRev:CTCCATTCCCACCGCCAACT,IntFwd:GAAGGCTAGGCGGAGGAAGA,ExtFwd:GTGCGTAGCAAGAGAAATCT,IntRev:AAGGCAGTTGCTGAGACGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Maurer CW, Chiorazzi M, Shaham S.
Timing of the onset of a developmental cell death is controlled by transcriptional induction of the C. elegans ced-3 caspase-encoding gene.
Development 2007 134(7) 1357-68 
[ PubMed ID = 17329362 ] [ RRC reference ]

Yang M, Sun J, Sun X, Shen Q, Gao Z, Yang C.
Caenorhabditis elegans protein arginine methyltransferase PRMT-5 negatively regulates DNA damage-induced apoptosis.
PLoS Genet. 2009 5(6) e1000514 
[ PubMed ID = 19521535 ] [ RRC reference ]

García-Rodríguez FJ, Martínez-Fernández C, Brena D, Kukhtar D, Serrat X, Nadal E, Boxem M, Honnen S, Miranda-Vizuete A, Villanueva A, Cerón J.
Genetic and cellular sensitivity of Caenorhabditis elegans to the chemotherapeutic agent cisplatin.
Dis Model Mech 2018 11(6)  
[ PubMed ID = 29752286 ] [ RRC reference ]

Schumacher B, Schertel C, Wittenburg N, Tuck S, Mitani S, Gartner A, Conradt B, Shaham S.
C. elegans ced-13 can promote apoptosis and is induced in response to DNA damage.
Cell Death Differ. 2005 12(2) 153-61 
[ PubMed ID = 15605074 ] [ RRC reference ]

Ye AL, Ragle JM, Conradt B, Bhalla N.
Differential regulation of germline apoptosis in response to meiotic checkpoint activation.
Genetics 2014 198(3) 995-1000 
[ PubMed ID = 25217053 ] [ RRC reference ]

De Henau S, Tilleman L, Vangheel M, Luyckx E, Trashin S, Pauwels M, Germani F, Vlaeminck C, Vanfleteren JR, Bert W, Pesce A, Nardini M, Bolognesi M, De Wael K, Moens L, Dewilde S, Braeckman BP.
A redox signalling globin is essential for reproduction in Caenorhabditis elegans.
Nat Commun 2015 6 8782 
[ PubMed ID = 26621324 ] [ RRC reference ]

Morthorst TH, Olsen A.
Cell-nonautonomous inhibition of radiation-induced apoptosis by dynein light chain 1 in Caenorhabditis elegans.
Cell Death Dis 2013 4 e799 
[ PubMed ID = 24030151 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet. 2014 10(10) e1004747 
[ PubMed ID = 25340700 ] [ RRC reference ]