Mutants (Isolated)

tm5356

Allele Nametm5356
Sequence NameF25H2.2
CGC NameF25H2.2
Worm BaseAllele Name tm5356
CGC Name F25H2.2
Sequence F25H2.2
Phenotypehomozygous viable.
Mutation site9247/9248-9789/9790 (542 bp deletion)
ChromosomeI
Putative gene structurejoin(9119..9191, 9465..9952, 10448..10877, 11165..11556, 11601..11762, 12087..12278)
Map position5.07
Balancer
Map position of balancer
Sequence of primersExtFwd:TATTCCCCCCATATCCAGTC,ExtRev:TCGTAGACTTACCGTATACC,IntFwd:GCCGTTCGATGATTTATGTG,IntRev:CCATATGCCATTGAACTCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
McGough IJ, de Groot REA, Jellett AP, Betist MC, Varandas KC, Danson CM, Heesom KJ, Korswagen HC, Cullen PJ.
SNX3-retromer requires an evolutionary conserved MON2:DOPEY2:ATP9A complex to mediate Wntless sorting and Wnt secretion.
Nat Commun 2018 9(1) 3737 
[ PubMed ID = 30213940 ] [ RRC reference ]

Gleason RJ, Akintobi AM, Grant BD, Padgett RW.
BMP signaling requires retromer-dependent recycling of the type I receptor.
Proc Natl Acad Sci U S A 2014 111(7) 2578-83 
[ PubMed ID = 24550286 ] [ RRC reference ]

Vieira N, Bessa C, Rodrigues AJ, Marques P, Chan FY, de Carvalho AX, Correia-Neves M, Sousa N.
Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans.
Cell Mol Life Sci 2018 75(11) 2027-2044 
[ PubMed ID = 29196797 ] [ RRC reference ]