Mutants (Isolated)

tm5269

Allele Nametm5269
Allele TypeNormal
Sequence NameT01B6.3
Gene Nameaakg-4
Worm BaseAllele Name tm5269
Gene Name aakg-4
Sequence T01B6.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 6954/6955-7226/7227 (272 bp deletion)
ChromosomeX
Putative gene structureT01B6.3a=complement(join(6346..6492, 6543..6824, 7521..7610, 8273..8347, 8400..8463, 8875..8951, 9063..9206, 9265..9365, 9659..9728, 9778..10039, 10233..10318)); T01B6.3b=complement(join(6346..6492, 6543..6839))
Map position-15.79
Balancer
Map position of balancer
Sequence of primersIntRev:CAGGAGTTATCATTCAGGCT,IntFwd:GAAGATGATCGGTCCTCGGT,ExtRev:AGTCTCTGACACGCCGAGTT,ExtFwd:GGCATACTCGATGTGCTAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ju S, Chen H, Wang S, Lin J, Ma Y, Aroian RV, Peng D, Sun M.
C. elegans monitor energy status via the AMPK pathway to trigger innate immune responses against bacterial pathogens.
Commun Biol 2022 5(1) 643 
[ PubMed ID = 35773333 ] [ RRC reference ]