Home > Mutants (Isolated) > tm5258

Mutants (Isolated)

Allele Name		tm5258
Allele Type		Balanced
Sequence Name		T10E9.7
Gene Name		nuo-2
Worm Base	Allele Name	tm5258
	Gene Name	nuo-2
	Sequence	T10E9.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		10552/10553-10908/10909 (356 bp deletion)
Chromosome		I
Putative gene structure		complement(join(9142..9463, 10099..10289, 10520..10689, 10739..10865, 11283..11389, 11581..11869))
Map position		1.21
Balancer		hT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primers		ExtFwd:AGAAACAACGGATCCGGGAG,IntFwd:CAACGGATCCGGGAGCAATC,ExtRev:CACGCCAATTCGCTGAATCT,IntRev:CTTGCAAGGGAAATGCGCTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Meisel JD, Miranda M, Skinner OS, Wiesenthal PP, Wellner SM, Jourdain AA, Ruvkun G, Mootha VK. Hypoxia and intra-complex genetic suppressors rescue complex I mutants by a shared mechanism. Cell 2024 187(3) 659-675.e18  [ PubMed ID = 38215760 ] [ RRC reference ] Palmisano NJ, Meléndez A. Autophagy in C. elegans development. Dev Biol 2019 447(1) 103-125  [ PubMed ID = 29709599 ] [ RRC reference ]