Home > Mutants (Isolated) > tm5218

Mutants (Isolated)

Allele Name		tm5218
Allele Type		Normal
Sequence Name		T22H6.1
Gene Name		T22H6.1
Worm Base	Allele Name	tm5218
	Gene Name	T22H6.1
	Sequence	T22H6.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		3127/3128-3795/3796 (668 bp deletion)
Chromosome		X
Putative gene structure		complement(join(3057..3191, 3237..3338, 3391..3534, 4186..4369, 4498..4553))
Map position		8.39
Balancer
Map position of balancer
Sequence of primers		ExtFwd:AGATCTGACCACGAGGTCTT,IntFwd:ATCTCCATCCGCATTCGCAT,ExtRev:ATCACATTGAGGGTGGTAGA,IntRev:TTCCTACCGATGAGTACAGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Godthi A, Min S, Das S, Cruz-Corchado J, Deonarine A, Misel-Wuchter K, Issuree PD, Prahlad V. Neuronal IL-17 controls Caenorhabditis elegans developmental diapause through CEP-1/p53. Proc Natl Acad Sci U S A 2024 121(12) e2315248121  [ PubMed ID = 38483995 ] [ RRC reference ] Flynn SM, Chen C, Artan M, Barratt S, Crisp A, Nelson GM, Peak-Chew SY, Begum F, Skehel M, de Bono M. MALT-1 mediates IL-17 neural signaling to regulate C. elegans behavior, immunity and longevity. Nat Commun 2020 11(1) 2099  [ PubMed ID = 32350248 ] [ RRC reference ] Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M. IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses. Nature 2017 542(7639) 43-48  [ PubMed ID = 28099418 ] [ RRC reference ]