Mutants (Isolated)

tm5202

Allele Nametm5202
Sequence NameC34B7.2
CGC NameC34B7.2
Worm BaseAllele Name tm5202
CGC Name C34B7.2
Sequence C34B7.2
Phenotypehomozygous viable.
Mutation site7566/7567-7802/7803 (236 bp deletion)
ChromosomeI
Putative gene structurejoin(7072..7276, 7699..7811, 7865..8127, 8651..9665, 9725..10264, 11137..11595, 11649..11771)
Map position2.74
Balancer
Map position of balancer
Sequence of primersIntRev:CATCTGCTTCCAGTCGTCTC,ExtRev:AGTGTCCCTTAAAGGCGCAC,IntFwd:GACGACGCACCAAAAATACT,ExtFwd:CTATAAATCTCACACGCCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]