Mutants (Isolated)

tm520

Allele Nametm520
Sequence NameK08F8.4
CGC Namepah-1
Worm BaseAllele Name tm520
CGC Name pah-1
Sequence K08F8.4
Phenotypehomozygous viable. Dr. C. Loer: FASEB J. 22, 3046 (2008).
Mutation site25651/25652-26653/26654 (1002 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(24990..25164, 25210..25439, 25484..25610, 25786..25921, 25972..26168, 26281..26443, 26496..26688, 27097..27213, 27309..27344))
Map position0.88
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGCTGTCGTAGATGACGTG,IntRev:GCTCACGTTTTGTCTCTGTT,ExtFwd:GATCACTCACACCAAAACAC,ExtRev:TCGTATAAACGGCAACGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Calvo AC, Pey AL, Ying M, Loer CM, Martinez A.
Anabolic function of phenylalanine hydroxylase in Caenorhabditis elegans.
FASEB J. 2008 22(8) 3046-58 
[ PubMed ID = 18460651 ] [ RRC reference ]

Loer CM, Calvo AC, Watschinger K, Werner-Felmayer G, O'Rourke D, Stroud D, Tong A, Gotenstein JR, Chisholm AD, Hodgkin J, Werner ER, Martinez A.
Cuticle integrity and biogenic amine synthesis in Caenorhabditis elegans require the cofactor tetrahydrobiopterin (BH4).
Genetics 2015 200(1) 237-53 
[ PubMed ID = 25808955 ] [ RRC reference ]