Mutants (Isolated)

tm5192

Allele Nametm5192
Sequence NameF08A8.3
CGC NameF08A8.3
Worm BaseAllele Name tm5192
CGC Name F08A8.3
Sequence F08A8.3
Phenotypehomozygous viable.
Mutation site13577/13578-14401/14402 (824 bp deletion)
ChromosomeI
Putative gene structurejoin(13891..13995, 14258..14451, 14494..14654, 15049..15562, 15670..15934, 15982..16314, 17483..17758, 17801..17935)
Map position16
Balancer
Map position of balancer
Sequence of primersIntRev:ATCCGCTCCATTGAATGCCA,ExtRev:GTACCCAATCTTTGCATGAG,IntFwd:TCATCACAGACCAACTGATG,ExtFwd:CTACCGTCAGTCGAGAAGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang X, Feng L, Chinta S, Singh P, Wang Y, Nunnery JK, Butcher RA.
Acyl-CoA oxidase complexes control the chemical message produced by Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(13) 3955-60 
[ PubMed ID = 25775534 ] [ RRC reference ]