分離済み変異体

tm5192

Allele Nametm5192
BalanceNot Required
OutCrossNot Accepted
Sequence NameF08A8.3
Gene NameF08A8.3
Worm BaseAllele Name tm5192
Gene Name F08A8.3
Sequence F08A8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13577/13578-14401/14402 (824 bp deletion)
ChromosomeI
Putative gene structurejoin(13891..13995, 14258..14451, 14494..14654, 15049..15562, 15670..15934, 15982..16314, 17483..17758, 17801..17935)
Map position16
Balancer
Map position of balancer
Sequence of primersIntRev:ATCCGCTCCATTGAATGCCA,ExtRev:GTACCCAATCTTTGCATGAG,IntFwd:TCATCACAGACCAACTGATG,ExtFwd:CTACCGTCAGTCGAGAAGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang Y, Li C, Zhang J, Xu X, Fu L, Xu J, Zhu H, Hu Y, Li C, Wang M, Wu Y, Zou X, Liang B.
Polyunsaturated fatty acids promote the rapid fusion of lipid droplets in Caenorhabditis elegans.
J Biol Chem 2022 298(8) 102179 
[ PubMed ID = 35752365 ] [ RRC reference ]

Shimizu T, Sugiura K, Sakai Y, Dar AR, Butcher RA, Matsumoto K, Hisamoto N.
Chemical Signaling Regulates Axon Regeneration via the GPCR-Gqα Pathway in Caenorhabditis elegans.
J Neurosci 2022 42(5) 720-730 
[ PubMed ID = 34862187 ] [ RRC reference ]

Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]

Zhang X, Feng L, Chinta S, Singh P, Wang Y, Nunnery JK, Butcher RA.
Acyl-CoA oxidase complexes control the chemical message produced by Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2015 112(13) 3955-60 
[ PubMed ID = 25775534 ] [ RRC reference ]