Mutants (Isolated)

tm516

Allele Nametm516
Sequence NameF12F6.3
CGC Namerib-1
Worm BaseAllele Name tm516
CGC Name rib-1
Sequence F12F6.3
Phenotypelethal or sterile
Mutation site37528/37529-CTCTTGGATCTTTCAGGTAACTGTGTCTATGT-38014/38015(486 bp deletion + 32 bp insertion)
ChromosomeIV
Putative gene structurejoin(34900..34979, 35354..35497, 35542..35619, 35670..35850, 35900..35980, 37305..37469, 37909..38030, 38858..38984, 39222..39341, 39479..39529)
Map position5.01
Balancerdpy-20 (e1415) IV
Map position of balancer5.18
Sequence of primersIntRev:GATGACAACAGGAACACATC,ExtRev:AAGAATCCATGAGTCGGAGA,ExtFwd:TTCCACTGGACCTCTCCCAT,IntFwd:CCCATCTTCTCGTACATCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kitagawa H, Izumikawa T, Mizuguchi S, Dejima K, Nomura KH, Egusa N, Taniguchi F, Tamura J, Gengyo-Ando K, Mitani S, Nomura K, Sugahara K.
Expression of rib-1, a Caenorhabditis elegans homolog of the human tumor suppressor EXT genes, is indispensable for heparan sulfate synthesis and embryonic morphogenesis.
J. Biol. Chem. 2007 282(11) 8533-44 
[ PubMed ID = 17237233 ] [ RRC reference ]

Dejima K, Kang S, Mitani S, Cosman PC, Chisholm AD.
Syndecan defines precise spindle orientation by modulating Wnt signaling in C. elegans.
Development 2014 141(22) 4354-65 
[ PubMed ID = 25344071 ] [ RRC reference ]

Blanchette CR, Thackeray A, Perrat PN, Hekimi S, BĂ©nard CY.
Functional Requirements for Heparan Sulfate Biosynthesis in Morphogenesis and Nervous System Development in C. elegans.
PLoS Genet. 2017 13(1) e1006525 
[ PubMed ID = 28068429 ] [ RRC reference ]