Mutants (Isolated)

tm514

Allele Name

tm514

Sequence Name

B0336.1

CGC Name

wrm-1

Worm Base

Allele Name

tm514

CGC Name

wrm-1

Sequence

B0336.1

Phenotype

lethal or sterile. Dr. H. Sawa: Genes & Dev. 19, 1743-1748 (2005).

Mutation site

37283/37284-37706/37707 (423 bp deletion)

Chromosome

III

Putative gene structure

join(33493..33888, 35826..35883, 35935..36042, 36586..36758, 36816..37199, 37389..38268, 38318..38664, 38717..38883, 38940..39142, 39396..39574)

Map position

-1.45

Balancer

lon-1 (e185) III

Map position of balancer

-1.66

Sequence of primers

IntFwd:TGCAACCACCCATCTGAAAT,ExtFwd:TCAGGTTCCTCAACGGACCT,IntRev:CACCAAGACGTTCTGACATA,ExtRev:GATGAAAGAGGCTCACAACA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Cabello J, Neukomm LJ, Günesdogan U, Burkart K, Charette SJ, Lochnit G, Hengartner MO, Schnabel R.
The Wnt pathway controls cell death engulfment, spindle orientation, and migration through CED-10/Rac.
PLoS Biol 2010 8(2) e1000297
[ PubMed ID = 20126385 ] [ RRC reference ]

Kimura K, Kimura A.
Rab6 is required for the exocytosis of cortical granules and the recruitment of separase to the granules during the oocyte-to-embryo transition in Caenorhabditis elegans.
J Cell Sci 2012 125(Pt 23) 5897-905
[ PubMed ID = 22992455 ] [ RRC reference ]

Kim S, Ishidate T, Sharma R, Soto MC, Conte D Jr, Mello CC, Shirayama M.
Wnt and CDK-1 regulate cortical release of WRM-1/β-catenin to control cell division orientation in early Caenorhabditis elegans embryos.
Proc Natl Acad Sci U S A 2013 110(10) E918-27
[ PubMed ID = 23431196 ] [ RRC reference ]

Yang XD, Karhadkar TR, Medina J, Robertson SM, Lin R.
β-Catenin-related protein WRM-1 is a multifunctional regulatory subunit of the LIT-1 MAPK complex.
Proc Natl Acad Sci U S A 2015 112(2) E137-46
[ PubMed ID = 25548171 ] [ RRC reference ]

Baldwin AT, Phillips BT.
The tumor suppressor APC differentially regulates multiple β-catenins through the function of axin and CKIα during C. elegans asymmetric stem cell divisions.
J Cell Sci 2014 127(Pt 12) 2771-81
[ PubMed ID = 24762815 ] [ RRC reference ]

Zacharias AL, Walton T, Preston E, Murray JI.
Quantitative Differences in Nuclear β-catenin and TCF Pattern Embryonic Cells in C. elegans.
PLoS Genet 2015 11(10) e1005585
[ PubMed ID = 26488501 ] [ RRC reference ]

Takeshita H, Sawa H.
Asymmetric cortical and nuclear localizations of WRM-1/beta-catenin during asymmetric cell division in C. elegans.
Genes Dev 2005 19(15) 1743-8
[ PubMed ID = 16077003 ] [ RRC reference ]

Nakamura K, Kim S, Ishidate T, Bei Y, Pang K, Shirayama M, Trzepacz C, Brownell DR, Mello CC.
Wnt signaling drives WRM-1/beta-catenin asymmetries in early C. elegans embryos.
Genes Dev 2005 19(15) 1749-54
[ PubMed ID = 16077004 ] [ RRC reference ]