分離済み変異体

tm514

Allele Name

tm514

Balance

Completed

OutCross

Not Accepted

Sequence Name

B0336.1

Gene Name

wrm-1

Worm Base

Allele Name

tm514 (x1)

Gene Name

wrm-1

Sequence

B0336.1

Phenotype

lethal or sterile. Dr. H. Sawa: Genes & Dev. 19, 1743-1748 (2005).

Mutation site

37283/37284-37706/37707 (423 bp deletion)

Chromosome

III

Putative gene structure

join(33493..33888, 35826..35883, 35935..36042, 36586..36758, 36816..37199, 37389..38268, 38318..38664, 38717..38883, 38940..39142, 39396..39574)

Map position

-1.45

Balancer

lon-1 (e185) III,hT2

Map position of balancer

Sequence of primers

IntFwd:TGCAACCACCCATCTGAAAT,ExtFwd:TCAGGTTCCTCAACGGACCT,IntRev:CACCAAGACGTTCTGACATA,ExtRev:GATGAAAGAGGCTCACAACA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Cao W, Fan Q, Amparado G, Begic D, Godini R, Gopal S, Pocock R.
A nucleic acid binding protein map of germline regulation in Caenorhabditis elegans.
Nat Commun 2024 15(1) 6884
[ PubMed ID = 39128930 ] [ RRC reference ]

Zacharias AL, Walton T, Preston E, Murray JI.
Quantitative Differences in Nuclear β-catenin and TCF Pattern Embryonic Cells in C. elegans.
PLoS Genet 2015 11(10) e1005585
[ PubMed ID = 26488501 ] [ RRC reference ]

Yang XD, Karhadkar TR, Medina J, Robertson SM, Lin R.
β-Catenin-related protein WRM-1 is a multifunctional regulatory subunit of the LIT-1 MAPK complex.
Proc Natl Acad Sci U S A 2015 112(2) E137-46
[ PubMed ID = 25548171 ] [ RRC reference ]

Baldwin AT, Phillips BT.
The tumor suppressor APC differentially regulates multiple β-catenins through the function of axin and CKIα during C. elegans asymmetric stem cell divisions.
J Cell Sci 2014 127(Pt 12) 2771-81
[ PubMed ID = 24762815 ] [ RRC reference ]

Kim S, Ishidate T, Sharma R, Soto MC, Conte D Jr, Mello CC, Shirayama M.
Wnt and CDK-1 regulate cortical release of WRM-1/β-catenin to control cell division orientation in early Caenorhabditis elegans embryos.
Proc Natl Acad Sci U S A 2013 110(10) E918-27
[ PubMed ID = 23431196 ] [ RRC reference ]

Kimura K, Kimura A.
Rab6 is required for the exocytosis of cortical granules and the recruitment of separase to the granules during the oocyte-to-embryo transition in Caenorhabditis elegans.
J Cell Sci 2012 125(Pt 23) 5897-905
[ PubMed ID = 22992455 ] [ RRC reference ]

Cabello J, Neukomm LJ, Günesdogan U, Burkart K, Charette SJ, Lochnit G, Hengartner MO, Schnabel R.
The Wnt pathway controls cell death engulfment, spindle orientation, and migration through CED-10/Rac.
PLoS Biol 2010 8(2) e1000297
[ PubMed ID = 20126385 ] [ RRC reference ]

Nakamura K, Kim S, Ishidate T, Bei Y, Pang K, Shirayama M, Trzepacz C, Brownell DR, Mello CC.
Wnt signaling drives WRM-1/beta-catenin asymmetries in early C. elegans embryos.
Genes Dev 2005 19(15) 1749-54
[ PubMed ID = 16077004 ] [ RRC reference ]

Takeshita H, Sawa H.
Asymmetric cortical and nuclear localizations of WRM-1/beta-catenin during asymmetric cell division in C. elegans.
Genes Dev 2005 19(15) 1743-8
[ PubMed ID = 16077003 ] [ RRC reference ]