Mutants (Isolated)

tm5127

Allele Nametm5127
Sequence NameW02H5.8
CGC NameW02H5.8
Worm BaseAllele Name tm5127
CGC Name W02H5.8
Sequence W02H5.8
Phenotypehomozygous viable.
Mutation site32892/32893-33145/33146 (253 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(28799..28957, 29969..30702, 32285..32833, 32977..33178, 34185..34277))
Map position-13.39
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGAGCGTAGTGTGTCCAAC,ExtFwd:TTCCATCTTCGAGCGTAGTG,IntRev:CGGTCACCGTACTTCTGCAC,ExtRev:GCATTAAAGGCGCACACATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]