Mutants (Isolated)

tm5075

Allele Nametm5075
BalanceNot Required
OutCrossNot Accepted
Sequence NameR09E10.3
Gene Nameacs-18
Worm BaseAllele Name tm5075
Gene Name acs-18
Sequence R09E10.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 27336/27337-27956/27957 (620 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(26202..26366, 26449..26592, 26894..27503, 27551..27748, 27798..28179, 28229..28373, 28424..28621, 28667..28840, 28924..29010))
Map position4.57
Balancer
Map position of balancer
Sequence of primersExtFwd:TTACCTCTGGATCTGGGACA,IntFwd:GAGATCTGGAGCCACAAACT,ExtRev:AGTGACATCTTCTACGCGGT,IntRev:AGTGACTCGCTGTCAGCTTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Park YJ, Yeon J, Cho J, Kim DY, Bai X, Oh Y, Kim J, Nam H, Hwang H, Heo W, Kim J, Jun S, Lee K, Kang K, Kim K.
PIEZO acts in an intestinal valve to regulate swallowing in C. elegans.
Nat Commun 2024 15(1) 10072 
[ PubMed ID = 39567502 ] [ RRC reference ]