分離済み変異体

tm5030

Allele Name

tm5030

Allele Type

通常株

Sequence Name

R13H8.1

Gene Name

daf-16

Worm Base

Allele Name

tm5030

Gene Name

daf-16

Sequence

R13H8.1

Phenotype

homozygous viable.

Mutation site

6429/6430-6622/6623 (193 bp deletion)

Chromosome

Putative gene structure

R13H8.1a=join(14814..15455, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356) daf-16f=join([H36N01] 3907..3930, 4169..4259, 4313..4463, [R13H8] 6960..7012, 7657..7802, 8516..8589, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356) daf-16b.=join(6409..6653, 6896..7012, 7663..7802, 8516..8589, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356)

Map position

5.08

Balancer

Map position of balancer

Sequence of primers

IntRev:CATTGCTCCCGTATAGGCTG,ExtRev:CCGAGCTGTCCACATTGCTC,IntFwd:ACCGTTCAAGCTGCTGCCTT,ExtFwd:AGCCGAAGCAATCAAGACCT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Kim Y, Lee SB, Cho M, Choe S, Jang M.
Indian Almond (Terminalia catappa Linn.) Leaf Extract Extends Lifespan by Improving Lipid Metabolism and Antioxidant Activity Dependent on AMPK Signaling Pathway in Caenorhabditis elegans under High-Glucose-Diet Conditions.
Antioxidants (Basel) 2023 13(1)
[ PubMed ID = 38275634 ] [ RRC reference ]

Ham S, Kim SS, Park S, Kwon HC, Ha SG, Bae Y, Lee GY, Lee SV.
Combinatorial transcriptomic and genetic dissection of insulin/IGF-1 signaling-regulated longevity in Caenorhabditis elegans.
Aging Cell 2024 e14151
[ PubMed ID = 38529797 ] [ RRC reference ]

Kim Y, Nam S, Lim J, Jang M.
Autumn Olive (Elaeagnus umbellata Thunb.) Berries Improve Lipid Metabolism and Delay Aging in Middle-Aged Caenorhabditis elegans.
Int J Mol Sci 2024 25(6)
[ PubMed ID = 38542392 ] [ RRC reference ]

Cuko L, Cale AR, Rambo L, Knoblock ML, Karp X.
Distinct daf-16 isoforms regulate specification of vulval precursor cells in Caenorhabditis elegans.
MicroPubl Biol 2022 2022
[ PubMed ID = 36575736 ] [ RRC reference ]

Wirick MJ, Cale AR, Smith IT, Alessi AF, Starostik MR, Cuko L, Lalk K, Schmidt MN, Olson BS, Salomon PM, Santos A, Schmitter-Sánchez A, Galagali H, Ranke KJ, Wolbert PA, Knoblock ML, Kim JK, Karp X.
daf-16/FOXO blocks adult cell fate in Caenorhabditis elegans dauer larvae via lin-41/TRIM71.
PLoS Genet 2021 17(11) e1009881
[ PubMed ID = 34780472 ] [ RRC reference ]

Zhao Y, Zhang B, Marcu I, Athar F, Wang H, Galimov ER, Chapman H, Gems D.
Mutation of daf-2 extends lifespan via tissue-specific effectors that suppress distinct life-limiting pathologies.
Aging Cell 2021 20(3) e13324
[ PubMed ID = 33609424 ] [ RRC reference ]

Nagashima T, Iino Y, Tomioka M.
DAF-16/FOXO promotes taste avoidance learning independently of axonal insulin-like signaling.
PLoS Genet 2019 15(7) e1008297
[ PubMed ID = 31323047 ] [ RRC reference ]

Chen AT, Guo C, Itani OA, Budaitis BG, Williams TW, Hopkins CE, McEachin RC, Pande M, Grant AR, Yoshina S, Mitani S, Hu PJ.
Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.
Genetics 2015 201(2) 613-29
[ PubMed ID = 26219299 ] [ RRC reference ]