Mutants (Isolated)

tm5028

Allele Nametm5028
Sequence NameF17C8.1
CGC Nameacy-1
Worm BaseAllele Name tm5028
CGC Name acy-1
Sequence F17C8.1
Phenotypelethal or sterile
Mutation site10446/10447-10793/10794 (347 bp deletion)
ChromosomeIII
Putative gene structurejoin(5261..5545, 7746..7819, 7929..8052, 8508..8810, 9358..9454, 9502..9717, 9768..10123, 10471..11329, 11579..12048, 12093..12278, 12518..13028, 13125..13342, 13551..13613)
Map position-2.64
Balancer
Map position of balancer
Sequence of primersIntFwd:GACTGTTCCGAATTCCCCTG,ExtFwd:CGCCCCACAAATCAGCTAAT,IntRev:GACCGTTGATCCAGTAATTC,ExtRev:ACCACCTGTTTTCAGACACG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu F, Xiao Y, Ji XL, Zhang KQ, Zou CG.
The cAMP-PKA pathway-mediated fat mobilization is required for cold tolerance in C. elegans.
Sci Rep 2017 7(1) 638 
[ PubMed ID = 28377576 ] [ RRC reference ]