Mutants (Isolated)

tm5007

Allele Nametm5007
Sequence NameR06A4.7
CGC Namemes-2
Worm BaseAllele Name tm5007
CGC Name mes-2
Sequence R06A4.7
Phenotypehomozygous viable.
Mutation site33035/33036-33199/33200 (164 bp deletion)
ChromosomeII
Putative gene structurejoin(33123..33789, 34173..34741, 35184..35332, 35377..35594, 36015..36207, 36473..36633, Z81515.1:105..176, Z81515.1:393..603, Z81515.1:836..917)
Map position22.96
Balancer
Map position of balancer
Sequence of primersExtRev:CCCGAGGTTTGATGCATGTC,IntFwd:ATAGGGCGCGATTGCACGCA,IntRev:ATGGTACCTTCGTCCCGCCT,ExtFwd:TTCGCGCCTGGGTAACATAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Guillermo ARR, Chocian K, Gavriilidis G, Vandamme J, Salcini AE, Mellor J, Woollard A.
H3K27 modifiers regulate lifespan in C. elegans in a context-dependent manner.
BMC Biol 2021 19(1) 59 
[ PubMed ID = 33766022 ] [ RRC reference ]