Mutants (Isolated)

tm499

Allele Nametm499
Sequence NameF35G12.10
CGC Nameasb-1
Worm BaseAllele Name tm499
CGC Name asb-1
Sequence F35G12.10
Phenotypelethal or sterile
Mutation site28429/28430-28983/28934 (554 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(28456..28657, 28779..28977, 29021..29383, 29426..29491, 29539.. 29614))
Map position-3.3
Balancer
Map position of balancer
Sequence of primersIntRev:CCGATGGCACTACGAATACA,ExtFwd:GGTAATGCTCATCCGAGTGT,ExtRev:TCTGGAGCCATCGTCGTTTT,IntFwd:CCTGGATGATCATCCTGCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kawasaki I, Hanazawa M, Gengyo-Ando K, Mitani S, Maruyama I, Iino Y.
ASB-1, a germline-specific isoform of mitochondrial ATP synthase b subunit, is required to maintain the rate of germline development in Caenorhabditis elegans.
Mech. Dev. 2007 124(3) 237-51 
[ PubMed ID = 17223323 ] [ RRC reference ]