Mutants (Isolated)

tm4977

Allele Nametm4977
Allele TypeNormal
Sequence NameM60.2
Gene NameM60.2
Worm BaseAllele Name tm4977
Gene Name M60.2
Sequence M60.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10580/10581-11200/11201 (620 bp deletion)
ChromosomeX
Putative gene structurejoin(10779..10833, 10886..11103, 11236..11589, 14856..15053, 15110..15327, 15372..15682, 15808..15935, 15983..16061, 16110..16267)
Map position-0.27
Balancer
Map position of balancer
Sequence of primersExtFwd:GAATCCTTGTCTCGCCATTG,IntFwd:GCAGACGACCACCGCACAAT,ExtRev:GTCAGCTTGGATAGAGTCTA,IntRev:CTCTATCACTGCTACTCGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Xu F, Li R, von Gromoff ED, Drepper F, Knapp B, Warscheid B, Baumeister R, Qi W.
Reprogramming of the transcriptome after heat stress mediates heat hormesis in Caenorhabditis elegans.
Nat Commun 2023 14(1) 4176 
[ PubMed ID = 37443152 ] [ RRC reference ]

Qi W, Gromoff EDV, Xu F, Zhao Q, Yang W, Pfeifer D, Maier W, Long L, Baumeister R.
The secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans.
Nat Commun 2021 12(1) 1262 
[ PubMed ID = 33627668 ] [ RRC reference ]

Ujisawa T, Ohta A, Ii T, Minakuchi Y, Toyoda A, Ii M, Kuhara A.
Endoribonuclease ENDU-2 regulates multiple traits including cold tolerance via cell autonomous and nonautonomous controls in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2018 115(35) 8823-8828 
[ PubMed ID = 30104389 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412 
[ PubMed ID = 25048458 ] [ RRC reference ]