Home > Mutants (Isolated) > tm4977

Mutants (Isolated)

Allele Name		tm4977
Allele Type		Normal
Sequence Name		M60.2
Gene Name		M60.2
Worm Base	Allele Name	tm4977
	Gene Name	M60.2
	Sequence	M60.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		10580/10581-11200/11201 (620 bp deletion)
Chromosome		X
Putative gene structure		join(10779..10833, 10886..11103, 11236..11589, 14856..15053, 15110..15327, 15372..15682, 15808..15935, 15983..16061, 16110..16267)
Map position		-0.27
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GAATCCTTGTCTCGCCATTG,IntFwd:GCAGACGACCACCGCACAAT,ExtRev:GTCAGCTTGGATAGAGTCTA,IntRev:CTCTATCACTGCTACTCGAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV. The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction. bioRxiv 2023    [ PubMed ID = 38045350 ] [ RRC reference ] Xu F, Li R, von Gromoff ED, Drepper F, Knapp B, Warscheid B, Baumeister R, Qi W. Reprogramming of the transcriptome after heat stress mediates heat hormesis in Caenorhabditis elegans. Nat Commun 2023 14(1) 4176  [ PubMed ID = 37443152 ] [ RRC reference ] Qi W, Gromoff EDV, Xu F, Zhao Q, Yang W, Pfeifer D, Maier W, Long L, Baumeister R. The secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. Nat Commun 2021 12(1) 1262  [ PubMed ID = 33627668 ] [ RRC reference ] Ujisawa T, Ohta A, Ii T, Minakuchi Y, Toyoda A, Ii M, Kuhara A. Endoribonuclease ENDU-2 regulates multiple traits including cold tolerance via cell autonomous and nonautonomous controls in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2018 115(35) 8823-8828  [ PubMed ID = 30104389 ] [ RRC reference ] Ohta A, Ujisawa T, Sonoda S, Kuhara A. Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans. Nat Commun 2014 5 4412  [ PubMed ID = 25048458 ] [ RRC reference ]