Mutants (Isolated)

tm4960

Allele Nametm4960
Sequence NameT16H12.11
CGC NameT16H12.11
Worm BaseAllele Name tm4960
CGC Name T16H12.11
Sequence T16H12.11
Phenotypelethal or sterile
Mutation site10998/10999-11759/11760 (761 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(10864..11024, 11077..11262, 11312..11418, 11468..11744, 11795..11893, 11947..12004))
Map position1.8
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:GCACCCAAAGTGTTTCCTTC,IntFwd:GCCAACCGTAATAAACCGAT,ExtRev:CCACACCACGAGCTGATTAC,IntRev:TCATCCTGACACGAAGCCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang W, Miley N, Zastrow MS, MacQueen AJ, Sato A, Nabeshima K, Martinez-Perez E, Mlynarczyk-Evans S, Carlton PM, Villeneuve AM.
HAL-2 promotes homologous pairing during Caenorhabditis elegans meiosis by antagonizing inhibitory effects of synaptonemal complex precursors.
PLoS Genet 2012 8(8) e1002880 
[ PubMed ID = 22912597 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]