分離済み変異体

tm4924

Allele Nametm4924
BalanceNot Required
OutCrossNot Accepted
Sequence NameC15H9.7
Gene NameC15H9.7
Worm BaseAllele Name tm4924
Gene Name C15H9.7
Sequence C15H9.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19032/19033-TCGAAAATTTCGAAAATTT-19553/19554 (521 bp deletion + 19 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(18087..18209, 18304..18537, 18587..18672, 18729..18954, 19042..19335, 19382..19526, 19572..19692, 20163..20280, 20329..20418))
Map position-3.7
Balancer
Map position of balancer
Sequence of primersIntRev:ACTCACTCGGATTGATGCCA,IntFwd:GGTCAAATAGCATGAACGAC,ExtRev:TATGCGGAAACTCACTCGGA,ExtFwd:AAGTACTCCAGGTACCCGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Romanelli-Cedrez L, Vairoletti F, Salinas G.
Rhodoquinone-dependent electron transport chain is essential for Caenorhabditis elegans survival in hydrogen sulfide environments.
J Biol Chem 2024 300(9) 107708 
[ PubMed ID = 39178951 ] [ RRC reference ]

Meisel JD, Wiesenthal PP, Mootha VK, Ruvkun G.
CMTR-1 RNA methyltransferase mutations activate widespread expression of a dopaminergic neuron-specific mitochondrial complex I gene.
Curr Biol 2024 34(12) 2728-2738.e6 
[ PubMed ID = 38810637 ] [ RRC reference ]

Dang H, Castro-Portuguez R, Espejo L, Backer G, Freitas S, Spence E, Meyers J, Shuck K, Gardea EA, Chang LM, Balsa J, Thorns N, Corban C, Liu T, Bean S, Sheehan S, Korstanje R, Sutphin GL.
On the benefits of the tryptophan metabolite 3-hydroxyanthranilic acid in Caenorhabditis elegans and mouse aging.
Nat Commun 2023 14(1) 8338 
[ PubMed ID = 38097593 ] [ RRC reference ]

Roberts Buceta PM, Romanelli-Cedrez L, Babcock SJ, Xun H, VonPaige ML, Higley TW, Schlatter TD, Davis DC, Drexelius JA, Culver JC, Carrera I, Shepherd JN, Salinas G.
The kynurenine pathway is essential for rhodoquinone biosynthesis in Caenorhabditis elegans.
J Biol Chem 2019 294(28) 11047-11053 
[ PubMed ID = 31177094 ] [ RRC reference ]

Del Borrello S, Lautens M, Dolan K, Tan JH, Davie T, Schertzberg MR, Spensley MA, Caudy AA, Fraser AG.
Rhodoquinone biosynthesis in C. elegans requires precursors generated by the kynurenine pathway.
Elife 2019 8  
[ PubMed ID = 31232688 ] [ RRC reference ]

McReynolds MR, Wang W, Holleran LM, Hanna-Rose W.
Uridine monophosphate synthetase enables eukaryotic de novo NAD+ biosynthesis from quinolinic acid.
J Biol Chem 2017 292(27) 11147-11153 
[ PubMed ID = 28559281 ] [ RRC reference ]

van der Goot AT, Zhu W, Vázquez-Manrique RP, Seinstra RI, Dettmer K, Michels H, Farina F, Krijnen J, Melki R, Buijsman RC, Ruiz Silva M, Thijssen KL, Kema IP, Neri C, Oefner PJ, Nollen EA.
Delaying aging and the aging-associated decline in protein homeostasis by inhibition of tryptophan degradation.
Proc Natl Acad Sci U S A 2012 109(37) 14912-7 
[ PubMed ID = 22927396 ] [ RRC reference ]