Mutants (Isolated)

tm4924

Allele Nametm4924
Sequence NameC15H9.7
CGC NameC15H9.7
Worm BaseAllele Name tm4924
CGC Name C15H9.7
Sequence C15H9.7
Phenotypehomozygous viable.
Mutation site19032/19033-TCGAAAATTTCGAAAATTT-19553/19554 (521 bp deletion + 19 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(18087..18209, 18304..18537, 18587..18672, 18729..18954, 19042..19335, 19382..19526, 19572..19692, 20163..20280, 20329..20418))
Map position-3.7
Balancer
Map position of balancer
Sequence of primersIntRev:ACTCACTCGGATTGATGCCA,IntFwd:GGTCAAATAGCATGAACGAC,ExtRev:TATGCGGAAACTCACTCGGA,ExtFwd:AAGTACTCCAGGTACCCGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
McReynolds MR, Wang W, Holleran LM, Hanna-Rose W.
Uridine monophosphate synthetase enables eukaryotic de novo NAD+ biosynthesis from quinolinic acid.
J Biol Chem 2017 292(27) 11147-11153 
[ PubMed ID = 28559281 ] [ RRC reference ]

Del Borrello S, Lautens M, Dolan K, Tan JH, Davie T, Schertzberg MR, Spensley MA, Caudy AA, Fraser AG.
Rhodoquinone biosynthesis in C. elegans requires precursors generated by the kynurenine pathway.
Elife 2019 8  
[ PubMed ID = 31232688 ] [ RRC reference ]

Roberts Buceta PM, Romanelli-Cedrez L, Babcock SJ, Xun H, VonPaige ML, Higley TW, Schlatter TD, Davis DC, Drexelius JA, Culver JC, Carrera I, Shepherd JN, Salinas G.
The kynurenine pathway is essential for rhodoquinone biosynthesis in Caenorhabditis elegans.
J Biol Chem 2019 294(28) 11047-11053 
[ PubMed ID = 31177094 ] [ RRC reference ]

van der Goot AT, Zhu W, Vázquez-Manrique RP, Seinstra RI, Dettmer K, Michels H, Farina F, Krijnen J, Melki R, Buijsman RC, Ruiz Silva M, Thijssen KL, Kema IP, Neri C, Oefner PJ, Nollen EA.
Delaying aging and the aging-associated decline in protein homeostasis by inhibition of tryptophan degradation.
Proc Natl Acad Sci U S A 2012 109(37) 14912-7 
[ PubMed ID = 22927396 ] [ RRC reference ]