分離済み変異体

tm492

Allele Name

tm492

Allele Type

通常株

Sequence Name

F48F7.1

Gene Name

alg-1

Worm Base

Allele Name

tm492

Gene Name

alg-1

Sequence

F48F7.1

Phenotype

homozygous viable. Dr. R.H. Horvitz: sluggish, some adults become bloated and die. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. O. Hobert: no effect on DA, DB projection patterns. Dr. M. Hengartner: reduced brood size.

Mutation site

788/789-1398/1399 (610 bp deletion)

Chromosome

Putative gene structure

join(Z69663.1:30546..30755, 112..284, 431..601, 655..2117, 2173..3158)

Map position

15.1

Balancer

Map position of balancer

Sequence of primers

IntRev:GGTGGTATCCTCGGAAGTTC,ExtFwd:CCTACTCAGCCACAAACATT,ExtRev:GGCATCCGGATGAACCTAAA,IntFwd:CCTCAAAGACAAGCCGGAAG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Harvey LM, Frédérick PM, Gudipati RK, Michaud P, Houle F, Young D, Desbiens C, Ladouceur S, Dufour A, Großhans H, Simard MJ.
Dipeptidyl peptidase DPF-3 is a gatekeeper of microRNA Argonaute compensation in animals.
Nat Commun 2025 16(1) 2738
[ PubMed ID = 40108168 ] [ RRC reference ]

Zhen S, Rocheleau CE.
ALG-1, a microRNA argonaute, promotes vulva induction in C. elegans.
MicroPubl Biol 2024 2024
[ PubMed ID = 39493436 ] [ RRC reference ]

Li L, Zinovyeva AY.
Protein Extract Preparation and Co-immunoprecipitation from Caenorhabditis elegans.
J Vis Exp 2020 (159)
[ PubMed ID = 32510481 ] [ RRC reference ]

Li L, Veksler-Lublinsky I, Zinovyeva A.
HRPK-1, a conserved KH-domain protein, modulates microRNA activity during Caenorhabditis elegans development.
PLoS Genet 2019 15(10) e1008067
[ PubMed ID = 31584932 ] [ RRC reference ]

Jovanovic M, Reiter L, Picotti P, Lange V, Bogan E, Hurschler BA, Blenkiron C, Lehrbach NJ, Ding XC, Weiss M, Schrimpf SP, Miska EA, Grosshans H, Aebersold R, Hengartner MO.
A quantitative targeted proteomics approach to validate predicted microRNA targets in C. elegans.
Nat Methods 2010 7(10) 837-42
[ PubMed ID = 20835247 ] [ RRC reference ]

Jovanovic M, Reiter L, Clark A, Weiss M, Picotti P, Rehrauer H, Frei A, Neukomm LJ, Kaufman E, Wollscheid B, Simard MJ, Miska EA, Aebersold R, Gerber AP, Hengartner MO.
RIP-chip-SRM--a new combinatorial large-scale approach identifies a set of translationally regulated bantam/miR-58 targets in C. elegans.
Genome Res 2012 22(7) 1360-71
[ PubMed ID = 22454234 ] [ RRC reference ]

Bukhari SI, Vasquez-Rifo A, Gagné D, Paquet ER, Zetka M, Robert C, Masson JY, Simard MJ.
The microRNA pathway controls germ cell proliferation and differentiation in C. elegans.
Cell Res 2012 22(6) 1034-45
[ PubMed ID = 22370633 ] [ RRC reference ]

Zinovyeva AY, Bouasker S, Simard MJ, Hammell CM, Ambros V.
Mutations in conserved residues of the C. elegans microRNA Argonaute ALG-1 identify separable functions in ALG-1 miRISC loading and target repression.
PLoS Genet 2014 10(4) e1004286
[ PubMed ID = 24763381 ] [ RRC reference ]

Tops BB, Plasterk RH, Ketting RF.
The Caenorhabditis elegans Argonautes ALG-1 and ALG-2: almost identical yet different.
Cold Spring Harb Symp Quant Biol 2006 71 189-94
[ PubMed ID = 17381296 ] [ RRC reference ]