Mutants (Isolated)

tm492

Allele Nametm492
Sequence NameF48F7.1
CGC Namealg-1
Worm BaseAllele Name tm492
CGC Name alg-1
Sequence F48F7.1
Phenotypehomozygous viable. Dr. R.H. Horvitz: sluggish, some adults become bloated and die. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. O. Hobert: no effect on DA, DB projection patterns. Dr. M. Hengartner: reduced brood size.
Mutation site788/789-1398/1399 (610 bp deletion)
ChromosomeX
Putative gene structurejoin(Z69663.1:30546..30755, 112..284, 431..601, 655..2117, 2173..3158)
Map position15.1
Balancer
Map position of balancer
Sequence of primersExtRev:GGCATCCGGATGAACCTAAA,IntFwd:CCTCAAAGACAAGCCGGAAG,ExtFwd:CCTACTCAGCCACAAACATT,IntRev:GGTGGTATCCTCGGAAGTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tops BB, Plasterk RH, Ketting RF.
The Caenorhabditis elegans Argonautes ALG-1 and ALG-2: almost identical yet different.
Cold Spring Harb. Symp. Quant. Biol. 2006 71 189-94 
[ PubMed ID = 17381296 ] [ RRC reference ]

Bukhari SI, Vasquez-Rifo A, Gagné D, Paquet ER, Zetka M, Robert C, Masson JY, Simard MJ.
The microRNA pathway controls germ cell proliferation and differentiation in C. elegans.
Cell Res. 2012 22(6) 1034-45 
[ PubMed ID = 22370633 ] [ RRC reference ]

Jovanovic M, Reiter L, Clark A, Weiss M, Picotti P, Rehrauer H, Frei A, Neukomm LJ, Kaufman E, Wollscheid B, Simard MJ, Miska EA, Aebersold R, Gerber AP, Hengartner MO.
RIP-chip-SRM--a new combinatorial large-scale approach identifies a set of translationally regulated bantam/miR-58 targets in C. elegans.
Genome Res. 2012 22(7) 1360-71 
[ PubMed ID = 22454234 ] [ RRC reference ]

Jovanovic M, Reiter L, Picotti P, Lange V, Bogan E, Hurschler BA, Blenkiron C, Lehrbach NJ, Ding XC, Weiss M, Schrimpf SP, Miska EA, Grosshans H, Aebersold R, Hengartner MO.
A quantitative targeted proteomics approach to validate predicted microRNA targets in C. elegans.
Nat. Methods 2010 7(10) 837-42 
[ PubMed ID = 20835247 ] [ RRC reference ]

Zinovyeva AY, Bouasker S, Simard MJ, Hammell CM, Ambros V.
Mutations in conserved residues of the C. elegans microRNA Argonaute ALG-1 identify separable functions in ALG-1 miRISC loading and target repression.
PLoS Genet. 2014 10(4) e1004286 
[ PubMed ID = 24763381 ] [ RRC reference ]