Home > Mutants (Isolated) > tm4909

Mutants (Isolated)

Allele Name		tm4909
Allele Type		Normal
Sequence Name		Y37E3.4
Gene Name		Y37E3.4
Worm Base	Allele Name	tm4909
	Gene Name	Y37E3.4
	Sequence	Y37E3.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		5884/5885-6051/6052 (167 bp deletion)
Chromosome		I
Putative gene structure		join(5969..6070, 6134..6280)
Map position		-12.19
Balancer
Map position of balancer
Sequence of primers		ExtFwd:AAGTTCCACGTGTCCGCTAG,IntFwd:GTCTATCATTCTGACGTCTC,ExtRev:AGCGGCGGTTGCCATAGTTA,IntRev:GAGCCCGAGAGAGCACAAGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Pras A, Houben B, Aprile FA, Seinstra R, Gallardo R, Janssen L, Hogewerf W, Gallrein C, De Vleeschouwer M, Mata-Cabana A, Koopman M, Stroo E, de Vries M, Louise Edwards S, Kirstein J, Vendruscolo M, Falsone SF, Rousseau F, Schymkowitz J, Nollen EAA. The cellular modifier MOAG-4/SERF drives amyloid formation through charge complementation. EMBO J 2021 40(21) e107568  [ PubMed ID = 34617299 ] [ RRC reference ] van Ham TJ, Holmberg MA, van der Goot AT, Teuling E, Garcia-Arencibia M, Kim HE, Du D, Thijssen KL, Wiersma M, Burggraaff R, van Bergeijk P, van Rheenen J, Jerre van Veluw G, Hofstra RM, Rubinsztein DC, Nollen EA. Identification of MOAG-4/SERF as a regulator of age-related proteotoxicity. Cell 2010 142(4) 601-12  [ PubMed ID = 20723760 ] [ RRC reference ]