Mutants (Isolated)

tm4909

Allele Nametm4909
Sequence NameY37E3.4
CGC NameY37E3.4
Worm BaseAllele Name tm4909
CGC Name Y37E3.4
Sequence Y37E3.4
Phenotypehomozygous viable.
Mutation site5884/5885-6051/6052 (167 bp deletion)
ChromosomeI
Putative gene structurejoin(5969..6070, 6134..6280)
Map position-12.19
Balancer
Map position of balancer
Sequence of primersExtFwd:AAGTTCCACGTGTCCGCTAG,IntFwd:GTCTATCATTCTGACGTCTC,ExtRev:AGCGGCGGTTGCCATAGTTA,IntRev:GAGCCCGAGAGAGCACAAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
van Ham TJ, Holmberg MA, van der Goot AT, Teuling E, Garcia-Arencibia M, Kim HE, Du D, Thijssen KL, Wiersma M, Burggraaff R, van Bergeijk P, van Rheenen J, Jerre van Veluw G, Hofstra RM, Rubinsztein DC, Nollen EA.
Identification of MOAG-4/SERF as a regulator of age-related proteotoxicity.
Cell 2010 142(4) 601-12 
[ PubMed ID = 20723760 ] [ RRC reference ]