| Allele Name | tm4853 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C36A4.9 |
| Gene Name | acs-19 |
| Worm Base | Allele Name |
tm4853
|
| Gene Name |
acs-19
|
| Sequence |
C36A4.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 36972/36973-37442/37443 (470 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(35919..35978, 36029..36739, 36864..36979, 37038..37364, 37416..38244) |
| Map position | -42.5 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GTCTGGCACCATCTCCAGTG,ExtRev:CGTCCAGTTATCCACAAGTA,IntFwd:ACCTAGCCAACGATGGAGAA,ExtFwd:CATGTCGGACGTTCGCGTCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Ruan M, Xu F, Li N, Yu J, Teng F, Tang J, Huang C, Zhu H.
Free long-chain fatty acids trigger early postembryonic development in starved Caenorhabditis elegans by suppressing mTORC1.
PLoS Biol 2024 22(10) e3002841
[ PubMed ID = 39436954 ]
[ RRC reference ]
|
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Segref A, Kevei É, Pokrzywa W, Schmeisser K, Mansfeld J, Livnat-Levanon N, Ensenauer R, Glickman MH, Ristow M, Hoppe T.
Pathogenesis of human mitochondrial diseases is modulated by reduced activity of the ubiquitin/proteasome system.
Cell Metab 2014 19(4) 642-52
[ PubMed ID = 24703696 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.