Mutants (Isolated)

tm4853

Allele Nametm4853
Sequence NameC36A4.9
CGC Nameacs-19
Worm BaseAllele Name tm4853
CGC Name acs-19
Sequence C36A4.9
Phenotypehomozygous viable.
Mutation site36972/36973-37442/37443 (470 bp deletion)
ChromosomeIII
Putative gene structurejoin(35919..35978, 36029..36739, 36864..36979, 37038..37364, 37416..38244)
Map position-42.5
Balancer
Map position of balancer
Sequence of primersIntRev:GTCTGGCACCATCTCCAGTG,ExtRev:CGTCCAGTTATCCACAAGTA,IntFwd:ACCTAGCCAACGATGGAGAA,ExtFwd:CATGTCGGACGTTCGCGTCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Segref A, Kevei É, Pokrzywa W, Schmeisser K, Mansfeld J, Livnat-Levanon N, Ensenauer R, Glickman MH, Ristow M, Hoppe T.
Pathogenesis of human mitochondrial diseases is modulated by reduced activity of the ubiquitin/proteasome system.
Cell Metab. 2014 19(4) 642-52 
[ PubMed ID = 24703696 ] [ RRC reference ]