分離済み変異体

tm483

Allele Nametm483
BalanceCompleted
OutCrossNot Accepted
Sequence NameT05G5.10
Gene Nameiff-1
Worm BaseAllele Name tm483 (x1)
Gene Name iff-1
Sequence T05G5.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. Y. Iino: Mech. Dev. 121, 213-224 (2004).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17474/17475-18290/18291 (816 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(17401..17466, 17516..17653, 17772..17924, 17969..18097))
Map position0.92
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtRev:GAGGGTGGATGGCGAGAGTT,IntFwd:GCAAGCCGGAGATAGGAAAA,IntRev:CCGAAGACCATAGAGAGGTA,ExtFwd:TGTTTGCGAATGTGAAGGCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lee HJ, Noormohammadi A, Koyuncu S, Calculli G, Simic MS, Herholz M, Trifunovic A, Vilchez D.
Prostaglandin signals from adult germ stem cells delay somatic aging of Caenorhabditis elegans.
Nat Metab 2019 1(8) 790-810 
[ PubMed ID = 31485561 ] [ RRC reference ]

Govindan JA, Jayamani E, Zhang X, Breen P, Larkins-Ford J, Mylonakis E, Ruvkun G.
Lipid signalling couples translational surveillance to systemic detoxification in Caenorhabditis elegans.
Nat Cell Biol 2015 17(10) 1294-303 
[ PubMed ID = 26322678 ] [ RRC reference ]

Hanazawa M, Kawasaki I, Kunitomo H, Gengyo-Ando K, Bennett KL, Mitani S, Iino Y.
The Caenorhabditis elegans eukaryotic initiation factor 5A homologue, IFF-1, is required for germ cell proliferation, gametogenesis and localization of the P-granule component PGL-1.
Mech Dev 2004 121(3) 213-24 
[ PubMed ID = 15003625 ] [ RRC reference ]