Mutants (Isolated)

tm483

Allele Nametm483
Sequence NameT05G5.10
CGC Nameiff-1
Worm BaseAllele Name tm483
CGC Name iff-1
Sequence T05G5.10
Phenotypelethal or sterile. Dr. Y. Iino: Mech. Dev. 121, 213-224 (2004).
Mutation site17474/17475-18290/18291 (816 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(17401..17466, 17516..17653, 17772..17924, 17969..18097))
Map position0.92
Balancer
Map position of balancer
Sequence of primersExtRev:GAGGGTGGATGGCGAGAGTT,IntFwd:GCAAGCCGGAGATAGGAAAA,IntRev:CCGAAGACCATAGAGAGGTA,ExtFwd:TGTTTGCGAATGTGAAGGCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Govindan JA, Jayamani E, Zhang X, Breen P, Larkins-Ford J, Mylonakis E, Ruvkun G.
Lipid signalling couples translational surveillance to systemic detoxification in Caenorhabditis elegans.
Nat. Cell Biol. 2015 17(10) 1294-303 
[ PubMed ID = 26322678 ] [ RRC reference ]

Hanazawa M, Kawasaki I, Kunitomo H, Gengyo-Ando K, Bennett KL, Mitani S, Iino Y.
The Caenorhabditis elegans eukaryotic initiation factor 5A homologue, IFF-1, is required for germ cell proliferation, gametogenesis and localization of the P-granule component PGL-1.
Mech. Dev. 2004 121(3) 213-24 
[ PubMed ID = 15003625 ] [ RRC reference ]