Mutants (Isolated)

tm4809

Allele Nametm4809
BalanceRequest Available
OutCrossNot Accepted
Sequence NameR06A4.8
Gene Nameagl-1
Worm BaseAllele Name tm4809
Gene Name agl-1
Sequence R06A4.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Gro.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 5002/5003-5930/5931 (928 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(24..887, 1260..1848, 2451..2877, 2925..3474, 3520..3736, 4707..5059, 5112..5455, 5527..5704, 5750..6549, 6596..6677))
Map position22.91
Balancer
Map position of balancer
Sequence of primersExtRev:AGGCCAATACAACGACCACA,IntRev:ATCCAGCGCTCGATGGGTGA,ExtFwd:GTCTTGCACCCCTAGAGGTC,IntFwd:CCTATAAACCAATCGTCCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]