Mutants (Isolated)

tm4762

Allele Nametm4762
BalanceNot Required
OutCrossNot Accepted
Sequence NameF56A8.1
Gene NameF56A8.1
Worm BaseAllele Name tm4762
Gene Name F56A8.1
Sequence F56A8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1159/1160-1361/1362 (202 bp deletion)
ChromosomeIII
Putative gene structurejoin(1162..1419, 1479..1658, 2228..2413, 2457..2566, 3325..3474, 3524..3613, 3677..3893, 4280..4684, 5170..5318, 5370..5460, 5640..5763, 6247..6315, 6363..6454, 6503..6583, 6636..6790, 7736..7813, 7878..8050, 8106..8203, 8251..8370, 8858..9063, 9384..9501)
Map position21.15
Balancer
Map position of balancer
Sequence of primersExtFwd:GTTAGGCCACCAATTTACAG,IntFwd:TTGGGCCATGCGGTTATAGA,ExtRev:GATAGGTGGCTCGCATACAA,IntRev:GGGTTTAACAACTTCCCGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zou W, Fan Y, Liu J, Cheng H, Hong H, Al-Sheikh U, Li S, Zhu L, Li R, He L, Tang YQ, Zhao G, Zhang Y, Wang F, Zhan R, Zheng X, Kang L.
Anoctamin-1 is a core component of a mechanosensory anion channel complex in C. elegans.
Nat Commun 2025 16(1) 1680 
[ PubMed ID = 39956854 ] [ RRC reference ]

Wang Y, Arnold ML, Smart AJ, Wang G, Androwski RJ, Morera A, Nguyen KCQ, Schweinsberg PJ, Bai G, Cooper J, Hall DH, Driscoll M, Grant BD.
Large vesicle extrusions from C. elegans neurons are consumed and stimulated by glial-like phagocytosis activity of the neighboring cell.
Elife 2023 12  
[ PubMed ID = 36861960 ] [ RRC reference ]

Furuta Y, Pena-Ramos O, Li Z, Chiao L, Zhou Z.
Calcium ions trigger the exposure of phosphatidylserine on the surface of necrotic cells.
PLoS Genet 2021 17(2) e1009066 
[ PubMed ID = 33571185 ] [ RRC reference ]

Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y.
Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD+ in axon regeneration.
Elife 2018 7  
[ PubMed ID = 30461420 ] [ RRC reference ]

Li Z, Venegas V, Nagaoka Y, Morino E, Raghavan P, Audhya A, Nakanishi Y, Zhou Z.
Necrotic Cells Actively Attract Phagocytes through the Collaborative Action of Two Distinct PS-Exposure Mechanisms.
PLoS Genet 2015 11(6) e1005285 
[ PubMed ID = 26061275 ] [ RRC reference ]

Wang Y, Alam T, Hill-Harfe K, Lopez AJ, Leung CK, Iribarne D, Bruggeman B, Miyamoto MM, Harfe BD, Choe KP.
Phylogenetic, expression, and functional analyses of anoctamin homologs in Caenorhabditis elegans.
Am J Physiol Regul Integr Comp Physiol 2013 305(11) R1376-89 
[ PubMed ID = 24049119 ] [ RRC reference ]