Allele Name | tm4762 |
Sequence Name | F56A8.1 |
CGC Name | F56A8.1 |
Worm Base | Allele Name |
tm4762
|
CGC Name |
F56A8.1
|
Sequence |
F56A8.1
|
Phenotype | homozygous viable. |
Mutation site | 1159/1160-1361/1362 (202 bp deletion) |
Chromosome | III |
Putative gene structure | join(1162..1419, 1479..1658, 2228..2413, 2457..2566, 3325..3474, 3524..3613, 3677..3893, 4280..4684, 5170..5318, 5370..5460, 5640..5763, 6247..6315, 6363..6454, 6503..6583, 6636..6790, 7736..7813, 7878..8050, 8106..8203, 8251..8370, 8858..9063, 9384..9501) |
Map position | 21.15 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GTTAGGCCACCAATTTACAG,IntFwd:TTGGGCCATGCGGTTATAGA,ExtRev:GATAGGTGGCTCGCATACAA,IntRev:GGGTTTAACAACTTCCCGAG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Li Z, Venegas V, Nagaoka Y, Morino E, Raghavan P, Audhya A, Nakanishi Y, Zhou Z. Necrotic Cells Actively Attract Phagocytes through the Collaborative Action of Two Distinct PS-Exposure Mechanisms. PLoS Genet 2015 11(6) e1005285
[ PubMed ID = 26061275 ]
[ RRC reference ]
|
Wang Y, Alam T, Hill-Harfe K, Lopez AJ, Leung CK, Iribarne D, Bruggeman B, Miyamoto MM, Harfe BD, Choe KP. Phylogenetic, expression, and functional analyses of anoctamin homologs in Caenorhabditis elegans. Am J Physiol Regul Integr Comp Physiol 2013 305(11) R1376-89
[ PubMed ID = 24049119 ]
[ RRC reference ]
|
Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y. Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD+ in axon regeneration. Elife 2018 7
[ PubMed ID = 30461420 ]
[ RRC reference ]
|
|