Mutants (Isolated)

tm4762

Allele Nametm4762
Sequence NameF56A8.1
CGC NameF56A8.1
Worm BaseAllele Name tm4762
CGC Name F56A8.1
Sequence F56A8.1
Phenotypehomozygous viable.
Mutation site1159/1160-1361/1362 (202 bp deletion)
ChromosomeIII
Putative gene structurejoin(1162..1419, 1479..1658, 2228..2413, 2457..2566, 3325..3474, 3524..3613, 3677..3893, 4280..4684, 5170..5318, 5370..5460, 5640..5763, 6247..6315, 6363..6454, 6503..6583, 6636..6790, 7736..7813, 7878..8050, 8106..8203, 8251..8370, 8858..9063, 9384..9501)
Map position21.15
Balancer
Map position of balancer
Sequence of primersExtFwd:GTTAGGCCACCAATTTACAG,IntFwd:TTGGGCCATGCGGTTATAGA,ExtRev:GATAGGTGGCTCGCATACAA,IntRev:GGGTTTAACAACTTCCCGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li Z, Venegas V, Nagaoka Y, Morino E, Raghavan P, Audhya A, Nakanishi Y, Zhou Z.
Necrotic Cells Actively Attract Phagocytes through the Collaborative Action of Two Distinct PS-Exposure Mechanisms.
PLoS Genet 2015 11(6) e1005285 
[ PubMed ID = 26061275 ] [ RRC reference ]

Wang Y, Alam T, Hill-Harfe K, Lopez AJ, Leung CK, Iribarne D, Bruggeman B, Miyamoto MM, Harfe BD, Choe KP.
Phylogenetic, expression, and functional analyses of anoctamin homologs in Caenorhabditis elegans.
Am J Physiol Regul Integr Comp Physiol 2013 305(11) R1376-89 
[ PubMed ID = 24049119 ] [ RRC reference ]

Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y.
Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD+ in axon regeneration.
Elife 2018 7  
[ PubMed ID = 30461420 ] [ RRC reference ]