Mutants (Isolated)

tm473

Allele Nametm473
BalanceNot Required
OutCrossNot Accepted
Sequence NameC53D5.5
Gene NameC53D5.5
Worm BaseAllele Name tm473
Gene Name C53D5.5
Sequence C53D5.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 38001/38002-C-38396/38397 (395 bp deletion + 1bp insertion)
ChromosomeI
Putative gene structurecomplement(join(36638..36826, 37028..37346, 37829..38552, 39309..39529, 39943..40172, 40280..40499, 41500..41525))
Map position-19.1
Balancer
Map position of balancer
Sequence of primersIntFwd:ACTCCTCCCCTTTTCGGAAA,ExtFwd:ATCAATATCCCGCTGGCGCT,IntRev:TTTTCAGGAGGAGAAGACGA,ExtRev:GAAGGGAGACGGGCCCAAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Brinkley DM, Smith KC, Fink EC, Kwen W, Yoo NH, West Z, Sullivan NL, Farthing AS, Hale VA, Goutte C.
Notch signaling without the APH-2/nicastrin subunit of gamma secretase in Caenorhabditis elegans germline stem cells.
Genetics 2024 227(3)  
[ PubMed ID = 38717968 ] [ RRC reference ]