Mutants (Isolated)

tm472

Allele Nametm472
Sequence NameB0285.5
CGC Namehse-5
Worm BaseAllele Name tm472
CGC Name hse-5
Sequence B0285.5
Phenotypehomozygous viable; Dr. O. Hobert: Neuron 41, 723-736 (2004)
Mutation site15975/15976-17223/17224 (1248 bp deletion)
ChromosomeIII
Putative gene structurejoin(14571..14615, 14657..14818, 15191..15485, 15715..15810, 15860..16018, 16144..16259, 16388..16658, 17070..17288, 17776..18311)
Map position-3.18
Balancer
Map position of balancer
Sequence of primersExtFwd:CGATCAAATCGCCATCGAAT,IntRev:TAGCACTGTGCCATCCGGGT,IntFwd:ATCTTCTGGTGGCTTGTGGA,ExtRev:GTTTTACCTTGAGCCATAGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rhiner C, Gysi S, Fröhli E, Hengartner MO, Hajnal A.
Syndecan regulates cell migration and axon guidance in C. elegans.
Development 2005 132(20) 4621-33 
[ PubMed ID = 16176946 ] [ RRC reference ]

Gumienny TL, MacNeil LT, Wang H, de Bono M, Wrana JL, Padgett RW.
Glypican LON-2 is a conserved negative regulator of BMP-like signaling in Caenorhabditis elegans.
Curr. Biol. 2007 17(2) 159-64 
[ PubMed ID = 17240342 ] [ RRC reference ]

Bülow HE, Hobert O.
Differential sulfations and epimerization define heparan sulfate specificity in nervous system development.
Neuron 2004 41(5) 723-36 
[ PubMed ID = 15003172 ] [ RRC reference ]

Sundararajan L, Norris ML, Lundquist EA.
SDN-1/Syndecan Acts in Parallel to the Transmembrane Molecule MIG-13 to Promote Anterior Neuroblast Migration.
G3 (Bethesda) 2015 5(8) 1567-74 
[ PubMed ID = 26022293 ] [ RRC reference ]

Wang X, Liu J, Zhu Z, Ou G.
The heparan sulfate-modifying enzyme glucuronyl C5-epimerase HSE-5 controls Caenorhabditis elegans Q neuroblast polarization during migration.
Dev. Biol. 2015 399(2) 306-14 
[ PubMed ID = 25614236 ] [ RRC reference ]

Townley RA, Bülow HE.
Genetic analysis of the heparan modification network in Caenorhabditis elegans.
J. Biol. Chem. 2011 286(19) 16824-31 
[ PubMed ID = 21454666 ] [ RRC reference ]

Díaz-Balzac CA, Lázaro-Peña MI, Tecle E, Gomez N, Bülow HE.
Complex cooperative functions of heparan sulfate proteoglycans shape nervous system development in Caenorhabditis elegans.
G3 (Bethesda) 2014 4(10) 1859-70 
[ PubMed ID = 25098771 ] [ RRC reference ]

Hudson ML, Kinnunen T, Cinar HN, Chisholm AD.
C. elegans Kallmann syndrome protein KAL-1 interacts with syndecan and glypican to regulate neuronal cell migrations.
Dev. Biol. 2006 294(2) 352-65 
[ PubMed ID = 16677626 ] [ RRC reference ]

Edwards TJ, Hammarlund M.
Syndecan promotes axon regeneration by stabilizing growth cone migration.
Cell Rep 2014 8(1) 272-83 
[ PubMed ID = 25001284 ] [ RRC reference ]

Lázaro-Peña MI, Díaz-Balzac CA, Bülow HE, Emmons SW.
Synaptogenesis Is Modulated by Heparan Sulfate in Caenorhabditis elegans.
Genetics 2018 209(1) 195-208 
[ PubMed ID = 29559501 ] [ RRC reference ]

Blanchette CR, Thackeray A, Perrat PN, Hekimi S, Bénard CY.
Functional Requirements for Heparan Sulfate Biosynthesis in Morphogenesis and Nervous System Development in C. elegans.
PLoS Genet. 2017 13(1) e1006525 
[ PubMed ID = 28068429 ] [ RRC reference ]

Gysi S, Rhiner C, Flibotte S, Moerman DG, Hengartner MO.
A network of HSPG core proteins and HS modifying enzymes regulates netrin-dependent guidance of D-type motor neurons in Caenorhabditis elegans.
PLoS ONE 2013 8(9) e74908 
[ PubMed ID = 24066155 ] [ RRC reference ]

Attreed M, Desbois M, van Kuppevelt TH, Bülow HE.
Direct visualization of specifically modified extracellular glycans in living animals.
Nat. Methods 2012 9(5) 477-9 
[ PubMed ID = 22466794 ] [ RRC reference ]

Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63 
[ PubMed ID = 26811384 ] [ RRC reference ]