Mutants (Isolated)

tm472

Allele Nametm472
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0285.5
Gene Namehse-5
Worm BaseAllele Name tm472
Gene Name hse-5
Sequence B0285.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable; Dr. O. Hobert: Neuron 41, 723-736 (2004)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15975/15976-17223/17224 (1248 bp deletion)
ChromosomeIII
Putative gene structurejoin(14571..14615, 14657..14818, 15191..15485, 15715..15810, 15860..16018, 16144..16259, 16388..16658, 17070..17288, 17776..18311)
Map position-3.18
Balancer
Map position of balancer
Sequence of primersExtFwd:CGATCAAATCGCCATCGAAT,IntRev:TAGCACTGTGCCATCCGGGT,IntFwd:ATCTTCTGGTGGCTTGTGGA,ExtRev:GTTTTACCTTGAGCCATAGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705 
[ PubMed ID = 38239833 ] [ RRC reference ]

Cizeron M, Granger L, Bülow HE, Bessereau JL.
Specific heparan sulfate modifications stabilize the synaptic organizer MADD-4/Punctin at Caenorhabditis elegans neuromuscular junctions.
Genetics 2021 218(4)  
[ PubMed ID = 33983408 ] [ RRC reference ]

Lang AE, Lundquist EA.
The Collagens DPY-17 and SQT-3 Direct Anterior-Posterior Migration of the Q Neuroblasts in C. elegans.
J Dev Biol 2021 9(1)  
[ PubMed ID = 33669899 ] [ RRC reference ]

Liachko NF, Saxton AD, McMillan PJ, Strovas TJ, Keene CD, Bird TD, Kraemer BC.
Genome wide analysis reveals heparan sulfate epimerase modulates TDP-43 proteinopathy.
PLoS Genet 2019 15(12) e1008526 
[ PubMed ID = 31834878 ] [ RRC reference ]

Lázaro-Peña MI, Díaz-Balzac CA, Bülow HE, Emmons SW.
Synaptogenesis Is Modulated by Heparan Sulfate in Caenorhabditis elegans.
Genetics 2018 209(1) 195-208 
[ PubMed ID = 29559501 ] [ RRC reference ]

Blanchette CR, Thackeray A, Perrat PN, Hekimi S, Bénard CY.
Functional Requirements for Heparan Sulfate Biosynthesis in Morphogenesis and Nervous System Development in C. elegans.
PLoS Genet 2017 13(1) e1006525 
[ PubMed ID = 28068429 ] [ RRC reference ]

Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63 
[ PubMed ID = 26811384 ] [ RRC reference ]

Schwieterman AA, Steves AN, Yee V, Donelson CJ, Bentley MR, Santorella EM, Mehlenbacher TV, Pital A, Howard AM, Wilson MR, Ereddia DE, Effrein KS, McMurry JL, Ackley BD, Chisholm AD, Hudson ML.
The Caenorhabditis elegans Ephrin EFN-4 Functions Non-cell Autonomously with Heparan Sulfate Proteoglycans to Promote Axon Outgrowth and Branching.
Genetics 2016 202(2) 639-60 
[ PubMed ID = 26645816 ] [ RRC reference ]

Sundararajan L, Norris ML, Lundquist EA.
SDN-1/Syndecan Acts in Parallel to the Transmembrane Molecule MIG-13 to Promote Anterior Neuroblast Migration.
G3 (Bethesda) 2015 5(8) 1567-74 
[ PubMed ID = 26022293 ] [ RRC reference ]

Wang X, Liu J, Zhu Z, Ou G.
The heparan sulfate-modifying enzyme glucuronyl C5-epimerase HSE-5 controls Caenorhabditis elegans Q neuroblast polarization during migration.
Dev Biol 2015 399(2) 306-14 
[ PubMed ID = 25614236 ] [ RRC reference ]

Díaz-Balzac CA, Lázaro-Peña MI, Tecle E, Gomez N, Bülow HE.
Complex cooperative functions of heparan sulfate proteoglycans shape nervous system development in Caenorhabditis elegans.
G3 (Bethesda) 2014 4(10) 1859-70 
[ PubMed ID = 25098771 ] [ RRC reference ]

Edwards TJ, Hammarlund M.
Syndecan promotes axon regeneration by stabilizing growth cone migration.
Cell Rep 2014 8(1) 272-83 
[ PubMed ID = 25001284 ] [ RRC reference ]

Gysi S, Rhiner C, Flibotte S, Moerman DG, Hengartner MO.
A network of HSPG core proteins and HS modifying enzymes regulates netrin-dependent guidance of D-type motor neurons in Caenorhabditis elegans.
PLoS One 2013 8(9) e74908 
[ PubMed ID = 24066155 ] [ RRC reference ]

Attreed M, Desbois M, van Kuppevelt TH, Bülow HE.
Direct visualization of specifically modified extracellular glycans in living animals.
Nat Methods 2012 9(5) 477-9 
[ PubMed ID = 22466794 ] [ RRC reference ]

Townley RA, Bülow HE.
Genetic analysis of the heparan modification network in Caenorhabditis elegans.
J Biol Chem 2011 286(19) 16824-31 
[ PubMed ID = 21454666 ] [ RRC reference ]

Gumienny TL, MacNeil LT, Wang H, de Bono M, Wrana JL, Padgett RW.
Glypican LON-2 is a conserved negative regulator of BMP-like signaling in Caenorhabditis elegans.
Curr Biol 2007 17(2) 159-64 
[ PubMed ID = 17240342 ] [ RRC reference ]

Hudson ML, Kinnunen T, Cinar HN, Chisholm AD.
C. elegans Kallmann syndrome protein KAL-1 interacts with syndecan and glypican to regulate neuronal cell migrations.
Dev Biol 2006 294(2) 352-65 
[ PubMed ID = 16677626 ] [ RRC reference ]

Rhiner C, Gysi S, Fröhli E, Hengartner MO, Hajnal A.
Syndecan regulates cell migration and axon guidance in C. elegans.
Development 2005 132(20) 4621-33 
[ PubMed ID = 16176946 ] [ RRC reference ]

Bülow HE, Hobert O.
Differential sulfations and epimerization define heparan sulfate specificity in nervous system development.
Neuron 2004 41(5) 723-36 
[ PubMed ID = 15003172 ] [ RRC reference ]