分離済み変異体

tm4695

Allele Nametm4695
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0280.8
Gene Namenhr-10
Worm BaseAllele Name tm4695
Gene Name nhr-10
Sequence B0280.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12363/12364-12674/12675 (311 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(10615..10759, 10815..11185, 11541..11678, 11724..11897, 12381..12547, 12593..12672, 13288..13400))
Map position-0.79
Balancer
Map position of balancer
Sequence of primersIntFwd:GGTAGTTCTGTTGGTTACTC,ExtFwd:CTCTAGAGGATCAAGCACCA,IntRev:CCATCGTAGGCAAGTCCTTA,ExtRev:GGGATCTCGGGAAAAACCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Horowitz BB, Nanda S, Walhout AJM.
A transcriptional cofactor regulatory network for the C. elegans intestine.
G3 (Bethesda) 2023 13(7)  
[ PubMed ID = 37119809 ] [ RRC reference ]

Goh GYS, Beigi A, Yan J, Doering KRS, Taubert S.
Mediator subunit MDT-15 promotes expression of propionic acid breakdown genes to prevent embryonic lethality in Caenorhabditis elegans.
G3 (Bethesda) 2023 13(6)  
[ PubMed ID = 37075089 ] [ RRC reference ]

Bhattacharya S, Horowitz BB, Zhang J, Li X, Zhang H, Giese GE, Holdorf AD, Walhout AJM.
A metabolic regulatory network for the Caenorhabditis elegans intestine.
iScience 2022 25(8) 104688 
[ PubMed ID = 35847555 ] [ RRC reference ]

Giese GE, Walker MD, Ponomarova O, Zhang H, Li X, Minevich G, Walhout AJ.
Caenorhabditis elegans methionine/S-adenosylmethionine cycle activity is sensed and adjusted by a nuclear hormone receptor.
Elife 2020 9  
[ PubMed ID = 33016879 ] [ RRC reference ]

MacNeil LT, Pons C, Arda HE, Giese GE, Myers CL, Walhout AJ.
Transcription Factor Activity Mapping of a Tissue-Specific in vivo Gene Regulatory Network.
Cell Syst 2015 1(2) 152-162 
[ PubMed ID = 26430702 ] [ RRC reference ]

MacNeil LT, Watson E, Arda HE, Zhu LJ, Walhout AJ.
Diet-induced developmental acceleration independent of TOR and insulin in C. elegans.
Cell 2013 153(1) 240-52 
[ PubMed ID = 23540701 ] [ RRC reference ]

Watson E, MacNeil LT, Arda HE, Zhu LJ, Walhout AJM.
Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.
Cell 2013 153(1) 253-66 
[ PubMed ID = 23540702 ] [ RRC reference ]