Mutants (Isolated)

tm4695

Allele Nametm4695
Sequence NameB0280.8
CGC Namenhr-10
Worm BaseAllele Name tm4695
CGC Name nhr-10
Sequence B0280.8
Phenotypehomozygous viable.
Mutation site12363/12364-12674/12675 (311 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(10615..10759, 10815..11185, 11541..11678, 11724..11897, 12381..12547, 12593..12672, 13288..13400))
Map position-0.79
Balancer
Map position of balancer
Sequence of primersIntFwd:GGTAGTTCTGTTGGTTACTC,ExtFwd:CTCTAGAGGATCAAGCACCA,IntRev:CCATCGTAGGCAAGTCCTTA,ExtRev:GGGATCTCGGGAAAAACCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
MacNeil LT, Watson E, Arda HE, Zhu LJ, Walhout AJ.
Diet-induced developmental acceleration independent of TOR and insulin in C. elegans.
Cell 2013 153(1) 240-52 
[ PubMed ID = 23540701 ] [ RRC reference ]

Watson E, MacNeil LT, Arda HE, Zhu LJ, Walhout AJM.
Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.
Cell 2013 153(1) 253-66 
[ PubMed ID = 23540702 ] [ RRC reference ]

MacNeil LT, Pons C, Arda HE, Giese GE, Myers CL, Walhout AJ.
Transcription Factor Activity Mapping of a Tissue-Specific in vivo Gene Regulatory Network.
Cell Syst 2015 1(2) 152-162 
[ PubMed ID = 26430702 ] [ RRC reference ]