Mutants (Isolated)

tm4627

Allele Nametm4627
Sequence NameK06A4.5
CGC Namehaao-1
Worm BaseAllele Name tm4627
CGC Name haao-1
Sequence K06A4.5
Phenotypehomozygous viable.
Mutation site33092/33093-GATTGAAAA-33397/33398 (305 bp deletion + 9 bp insertion)
ChromosomeV
Putative gene structurejoin(33028..33271, 33535..33765, 33808..33922, 33974..34006, Z70751.1:105..186, Z70751.1:235..320, Z70751.1:366..420)
Map position2.04
Balancer
Map position of balancer
Sequence of primersIntRev:GGTACGGGTAAATCAGTCCA,ExtRev:GGTCCGTTTCTGAAAACTTC,IntFwd:ACGACTTCCGTTTCTACCGA,ExtFwd:ATCAGGAGCAAGTAGTCTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Roberts Buceta PM, Romanelli-Cedrez L, Babcock SJ, Xun H, VonPaige ML, Higley TW, Schlatter TD, Davis DC, Drexelius JA, Culver JC, Carrera I, Shepherd JN, Salinas G.
The kynurenine pathway is essential for rhodoquinone biosynthesis in Caenorhabditis elegans.
J Biol Chem 2019 294(28) 11047-11053 
[ PubMed ID = 31177094 ] [ RRC reference ]

van der Goot AT, Zhu W, Vázquez-Manrique RP, Seinstra RI, Dettmer K, Michels H, Farina F, Krijnen J, Melki R, Buijsman RC, Ruiz Silva M, Thijssen KL, Kema IP, Neri C, Oefner PJ, Nollen EA.
Delaying aging and the aging-associated decline in protein homeostasis by inhibition of tryptophan degradation.
Proc Natl Acad Sci U S A 2012 109(37) 14912-7 
[ PubMed ID = 22927396 ] [ RRC reference ]