分離済み変異体

tm4566

Allele Nametm4566
BalanceCompleted
OutCrossNot Accepted
Sequence NameF02E9.2
Gene Namelin-28
Worm BaseAllele Name tm4566 (x1)
Gene Name lin-28
Sequence F02E9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Let or Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4615/4616-AAAA-4948/4949 (333 bp deletion + 4 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(3766..4101, 4739..4945, 6268..6408))
Map position2.79
BalancerhT2
Map position of balancer
Sequence of primersExtRev:CCGGTGCCCATCAAATCTCA,IntFwd:CGGATTCCCGTATCTCAATA,ExtFwd:CCCCTAAATCGACACAGCTA,IntRev:TTCCAGTGACGATTCGGGGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Cao W, Fan Q, Amparado G, Begic D, Godini R, Gopal S, Pocock R.
A nucleic acid binding protein map of germline regulation in Caenorhabditis elegans.
Nat Commun 2024 15(1) 6884 
[ PubMed ID = 39128930 ] [ RRC reference ]

Wang D, Hou L, Nakamura S, Su M, Li F, Chen W, Yan Y, Green CD, Chen D, Zhang H, Antebi A, Han JJ.
LIN-28 balances longevity and germline stem cell number in Caenorhabditis elegans through let-7/AKT/DAF-16 axis.
Aging Cell 2017 16(1) 113-124 
[ PubMed ID = 27730721 ] [ RRC reference ]

Zinovyeva AY, Bouasker S, Simard MJ, Hammell CM, Ambros V.
Mutations in conserved residues of the C. elegans microRNA Argonaute ALG-1 identify separable functions in ALG-1 miRISC loading and target repression.
PLoS Genet 2014 10(4) e1004286 
[ PubMed ID = 24763381 ] [ RRC reference ]