Home > Mutants (Isolated) > tm4566

Mutants (Isolated)

Allele Name		tm4566
Allele Type		Balanced
Sequence Name		F02E9.2
Gene Name		lin-28
Worm Base	Allele Name	tm4566
	Gene Name	lin-28
	Sequence	F02E9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Let or Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		4615/4616-AAAA-4948/4949 (333 bp deletion + 4 bp insertion)
Chromosome		I
Putative gene structure		complement(join(3766..4101, 4739..4945, 6268..6408))
Map position		2.79
Balancer		hT2
Map position of balancer
Sequence of primers		ExtRev:CCGGTGCCCATCAAATCTCA,IntFwd:CGGATTCCCGTATCTCAATA,ExtFwd:CCCCTAAATCGACACAGCTA,IntRev:TTCCAGTGACGATTCGGGGT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Wang D, Hou L, Nakamura S, Su M, Li F, Chen W, Yan Y, Green CD, Chen D, Zhang H, Antebi A, Han JJ. LIN-28 balances longevity and germline stem cell number in Caenorhabditis elegans through let-7/AKT/DAF-16 axis. Aging Cell 2017 16(1) 113-124  [ PubMed ID = 27730721 ] [ RRC reference ] Zinovyeva AY, Bouasker S, Simard MJ, Hammell CM, Ambros V. Mutations in conserved residues of the C. elegans microRNA Argonaute ALG-1 identify separable functions in ALG-1 miRISC loading and target repression. PLoS Genet 2014 10(4) e1004286  [ PubMed ID = 24763381 ] [ RRC reference ]