Mutants (Isolated)

tm4547

Allele Nametm4547
Sequence NameD2024.2
CGC NameD2024.2
Worm BaseAllele Name tm4547
CGC Name D2024.2
Sequence D2024.2
Phenotypehomozygous viable.
Mutation site17814/17815-18239/18240 (425 bp deletion)
ChromosomeIV
Putative gene structurejoin(17794..17953, 17995..18071, 18134..18353, 18469..18571, 18621..18777, 18822..18920)
Map position3.31
Balancer
Map position of balancer
Sequence of primersIntRev:AATCCCACTCGACCTACCTC,ExtFwd:CGGTATCAATTCTCGTAGGT,IntFwd:AGAGAAGAGTGGCATGTCCA,ExtRev:TACTCCCCAGAAGTGTGATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Del Borrello S, Lautens M, Dolan K, Tan JH, Davie T, Schertzberg MR, Spensley MA, Caudy AA, Fraser AG.
Rhodoquinone biosynthesis in C. elegans requires precursors generated by the kynurenine pathway.
Elife 2019 8  
[ PubMed ID = 31232688 ] [ RRC reference ]

Roberts Buceta PM, Romanelli-Cedrez L, Babcock SJ, Xun H, VonPaige ML, Higley TW, Schlatter TD, Davis DC, Drexelius JA, Culver JC, Carrera I, Shepherd JN, Salinas G.
The kynurenine pathway is essential for rhodoquinone biosynthesis in Caenorhabditis elegans.
J Biol Chem 2019 294(28) 11047-11053 
[ PubMed ID = 31177094 ] [ RRC reference ]

van der Goot AT, Zhu W, Vázquez-Manrique RP, Seinstra RI, Dettmer K, Michels H, Farina F, Krijnen J, Melki R, Buijsman RC, Ruiz Silva M, Thijssen KL, Kema IP, Neri C, Oefner PJ, Nollen EA.
Delaying aging and the aging-associated decline in protein homeostasis by inhibition of tryptophan degradation.
Proc Natl Acad Sci U S A 2012 109(37) 14912-7 
[ PubMed ID = 22927396 ] [ RRC reference ]