Mutants (Isolated)

tm4529

Allele Nametm4529
BalanceNot Required
OutCrossNot Accepted
Sequence NameR07B7.5
Gene NameR07B7.5
Worm BaseAllele Name tm4529
Gene Name R07B7.5
Sequence R07B7.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11275/11276-11601/11602 (326 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(10387..10724, 10769..10826, 10881..11028, 11079..11187, 11238..11395, 11438..11533, 11590..11774, 11821..12114))
Map position3.62
Balancer
Map position of balancer
Sequence of primersIntRev:TTAAGATGCCATCCGTCGCA,ExtFwd:AAGACAATCCTCAAAGCCCT,ExtRev:CCGTATCACAACTAGCGTGT,IntFwd:CGAACACAATTCATTCCCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lemieux GA, Yoo S, Lin L, Vohra M, Ashrafi K.
The steroid hormone ADIOL promotes learning by reducing neural kynurenic acid levels.
Genes Dev 2023 37(21-24) 998-1016 
[ PubMed ID = 38092521 ] [ RRC reference ]

Higurashi S, Tsukada S, Aleogho BM, Park JH, Al-Hebri Y, Tanaka M, Nakano S, Mori I, Noma K.
Bacterial diet affects the age-dependent decline of associative learning in Caenorhabditis elegans.
Elife 2023 12  
[ PubMed ID = 37252859 ] [ RRC reference ]

Roberts Buceta PM, Romanelli-Cedrez L, Babcock SJ, Xun H, VonPaige ML, Higley TW, Schlatter TD, Davis DC, Drexelius JA, Culver JC, Carrera I, Shepherd JN, Salinas G.
The kynurenine pathway is essential for rhodoquinone biosynthesis in Caenorhabditis elegans.
J Biol Chem 2019 294(28) 11047-11053 
[ PubMed ID = 31177094 ] [ RRC reference ]

Del Borrello S, Lautens M, Dolan K, Tan JH, Davie T, Schertzberg MR, Spensley MA, Caudy AA, Fraser AG.
Rhodoquinone biosynthesis in C. elegans requires precursors generated by the kynurenine pathway.
Elife 2019 8  
[ PubMed ID = 31232688 ] [ RRC reference ]

Vohra M, Lemieux GA, Lin L, Ashrafi K.
The beneficial effects of dietary restriction on learning are distinct from its effects on longevity and mediated by depletion of a neuroinhibitory metabolite.
PLoS Biol 2017 15(8) e2002032 
[ PubMed ID = 28763436 ] [ RRC reference ]

Lemieux GA, Cunningham KA, Lin L, Mayer F, Werb Z, Ashrafi K.
Kynurenic acid is a nutritional cue that enables behavioral plasticity.
Cell 2015 160(1-2) 119-31 
[ PubMed ID = 25594177 ] [ RRC reference ]

van der Goot AT, Zhu W, Vázquez-Manrique RP, Seinstra RI, Dettmer K, Michels H, Farina F, Krijnen J, Melki R, Buijsman RC, Ruiz Silva M, Thijssen KL, Kema IP, Neri C, Oefner PJ, Nollen EA.
Delaying aging and the aging-associated decline in protein homeostasis by inhibition of tryptophan degradation.
Proc Natl Acad Sci U S A 2012 109(37) 14912-7 
[ PubMed ID = 22927396 ] [ RRC reference ]