Mutants (Isolated)

tm4525

Allele Name

tm4525

Sequence Name

ZC376.7

CGC Name

atfs-1

Worm Base

Allele Name

tm4525

CGC Name

atfs-1

Sequence

ZC376.7

Phenotype

homozygous viable.

Mutation site

25767/25768-GAAAAAT-26199/26200 (432 bp deletion + 7 bp insertion)

Chromosome

Putative gene structure

join(25621..25716, 25771..25841, 25891..26266, 27353..27424, 27477..27557, 27691..28343, 28442..28559)

Map position

6.2

Balancer

Map position of balancer

Sequence of primers

IntRev:TCCCGTACCATATTATCTCC,ExtRev:GTCGGCAATGCGAAAAAGAT,IntFwd:ATCCCCATAATGGTTCGCTG,ExtFwd:CACTGCCAATGTGAGTCATG

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Nargund AM, Pellegrino MW, Fiorese CJ, Baker BM, Haynes CM.
Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation.
Science 2012 337(6094) 587-90
[ PubMed ID = 22700657 ] [ RRC reference ]

Cai H, Rasulova M, Vandemeulebroucke L, Meagher L, Vlaeminck C, Dhondt I, Braeckman BP.
Life-Span Extension by Axenic Dietary Restriction Is Independent of the Mitochondrial Unfolded Protein Response and Mitohormesis in Caenorhabditis elegans.
J. Gerontol. A Biol. Sci. Med. Sci. 2017 72(10) 1311-1318
[ PubMed ID = 28329170 ] [ RRC reference ]

Labbadia J, Brielmann RM, Neto MF, Lin YF, Haynes CM, Morimoto RI.
Mitochondrial Stress Restores the Heat Shock Response and Prevents Proteostasis Collapse during Aging.
Cell Rep 2017 21(6) 1481-1494
[ PubMed ID = 29117555 ] [ RRC reference ]

Govindan JA, Jayamani E, Zhang X, Mylonakis E, Ruvkun G.
Dialogue between E. coli free radical pathways and the mitochondria of C. elegans.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(40) 12456-61
[ PubMed ID = 26392561 ] [ RRC reference ]

Nargund AM, Fiorese CJ, Pellegrino MW, Deng P, Haynes CM.
Mitochondrial and nuclear accumulation of the transcription factor ATFS-1 promotes OXPHOS recovery during the UPR(mt).
Mol. Cell 2015 58(1) 123-33
[ PubMed ID = 25773600 ] [ RRC reference ]

Liu Y, Samuel BS, Breen PC, Ruvkun G.
Caenorhabditis elegans pathways that surveil and defend mitochondria.
Nature 2014 508(7496) 406-10
[ PubMed ID = 24695221 ] [ RRC reference ]

Rainbolt TK, Atanassova N, Genereux JC, Wiseman RL.
Stress-regulated translational attenuation adapts mitochondrial protein import through Tim17A degradation.
Cell Metab. 2013 18(6) 908-19
[ PubMed ID = 24315374 ] [ RRC reference ]

Baker BM, Nargund AM, Sun T, Haynes CM.
Protective coupling of mitochondrial function and protein synthesis via the eIF2α kinase GCN-2.
PLoS Genet. 2012 8(6) e1002760
[ PubMed ID = 22719267 ] [ RRC reference ]

Gitschlag BL, Kirby CS, Samuels DC, Gangula RD, Mallal SA, Patel MR.
Homeostatic Responses Regulate Selfish Mitochondrial Genome Dynamics in C. elegans.
Cell Metab. 2016 24(1) 91-103
[ PubMed ID = 27411011 ] [ RRC reference ]

Shao LW, Niu R, Liu Y.
Neuropeptide signals cell non-autonomous mitochondrial unfolded protein response.
Cell Res. 2016 26(11) 1182-1196
[ PubMed ID = 27767096 ] [ RRC reference ]

Munkácsy E, Khan MH, Lane RK, Borror MB, Park JH, Bokov AF, Fisher AL, Link CD, Rea SL.
DLK-1, SEK-3 and PMK-3 Are Required for the Life Extension Induced by Mitochondrial Bioenergetic Disruption in C. elegans.
PLoS Genet. 2016 12(7) e1006133
[ PubMed ID = 27420916 ] [ RRC reference ]

Fiorese CJ, Schulz AM, Lin YF, Rosin N, Pellegrino MW, Haynes CM.
The Transcription Factor ATF5 Mediates a Mammalian Mitochondrial UPR.
Curr. Biol. 2016 26(15) 2037-2043
[ PubMed ID = 27426517 ] [ RRC reference ]

Köhler F, Müller-Rischart AK, Conradt B, Rolland SG.
The loss of LRPPRC function induces the mitochondrial unfolded protein response.
Aging (Albany NY) 2015 7(9) 701-17
[ PubMed ID = 26412102 ] [ RRC reference ]

Bennett CF, Vander Wende H, Simko M, Klum S, Barfield S, Choi H, Pineda VV, Kaeberlein M.
Activation of the mitochondrial unfolded protein response does not predict longevity in Caenorhabditis elegans.
Nat Commun 2014 5 3483
[ PubMed ID = 24662282 ] [ RRC reference ]

Oks O, Lewin S, Goncalves IL, Sapir A.
The UPR^mt Protects Caenorhabditis elegans from Mitochondrial Dysfunction by Upregulating Specific Enzymes of the Mevalonate Pathway.
Genetics 2018 209(2) 457-473
[ PubMed ID = 29599115 ] [ RRC reference ]

Kaufman DM, Crowder CM.
Mitochondrial Proteostatic Collapse Leads to Hypoxic Injury.
Curr. Biol. 2015 25(16) 2171-6
[ PubMed ID = 26234215 ] [ RRC reference ]

Pellegrino MW, Nargund AM, Kirienko NV, Gillis R, Fiorese CJ, Haynes CM.
Mitochondrial UPR-regulated innate immunity provides resistance to pathogen infection.
Nature 2014 516(7531) 414-7
[ PubMed ID = 25274306 ] [ RRC reference ]