Mutants (Isolated)

tm4525

Allele Name

tm4525

Sequence Name

ZC376.7

CGC Name

atfs-1

Worm Base

Allele Name

tm4525

CGC Name

atfs-1

Sequence

ZC376.7

Phenotype

homozygous viable.

Mutation site

25767/25768-GAAAAAT-26199/26200 (432 bp deletion + 7 bp insertion)

Chromosome

Putative gene structure

join(25621..25716, 25771..25841, 25891..26266, 27353..27424, 27477..27557, 27691..28343, 28442..28559)

Map position

6.2

Balancer

Map position of balancer

Sequence of primers

IntRev:TCCCGTACCATATTATCTCC,ExtRev:GTCGGCAATGCGAAAAAGAT,IntFwd:ATCCCCATAATGGTTCGCTG,ExtFwd:CACTGCCAATGTGAGTCATG

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Littlejohn NK, Seban N, Liu CC, Srinivasan S.
A feedback loop governs the relationship between lipid metabolism and longevity.
Elife 2020 9
[ PubMed ID = 33078707 ] [ RRC reference ]

Amin MR, Mahmud SA, Dowgielewicz JL, Sapkota M, Pellegrino MW.
A novel gene-diet interaction promotes organismal lifespan and host protection during infection via the mitochondrial UPR.
PLoS Genet 2020 16(12) e1009234
[ PubMed ID = 33338044 ] [ RRC reference ]

Zhou B, Kreuzer J, Kumsta C, Wu L, Kamer KJ, Cedillo L, Zhang Y, Li S, Kacergis MC, Webster CM, Fejes-Toth G, Naray-Fejes-Toth A, Das S, Hansen M, Haas W, Soukas AA.
Mitochondrial Permeability Uncouples Elevated Autophagy and Lifespan Extension.
Cell 2019 177(2) 299-314.e16
[ PubMed ID = 30929899 ] [ RRC reference ]

Dimos BA, Mahmud SA, Fuess LE, Mydlarz LD, Pellegrino MW.
Uncovering a mitochondrial unfolded protein response in corals and its role in adapting to a changing world.
Proc Biol Sci 2019 286(1905) 20190470
[ PubMed ID = 31238849 ] [ RRC reference ]

Rolland SG, Schneid S, Schwarz M, Rackles E, Fischer C, Haeussler S, Regmi SG, Yeroslaviz A, Habermann B, Mokranjac D, Lambie E, Conradt B.
Compromised Mitochondrial Protein Import Acts as a Signal for UPR^mt.
Cell Rep 2019 28(7) 1659-1669.e5
[ PubMed ID = 31412237 ] [ RRC reference ]

Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, Machiela E, Schaar CE, DeJonge H, Blackwell TK, Van Raamsdonk JM.
Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways.
BMC Biol 2018 16(1) 147
[ PubMed ID = 30563508 ] [ RRC reference ]

Solis GM, Kardakaris R, Valentine ER, Bar-Peled L, Chen AL, Blewett MM, McCormick MA, Williamson JR, Kennedy B, Cravatt BF, Petrascheck M.
Translation attenuation by minocycline enhances longevity and proteostasis in old post-stress-responsive organisms.
Elife 2018 7
[ PubMed ID = 30479271 ] [ RRC reference ]

Gao K, Li Y, Hu S, Liu Y.
SUMO peptidase ULP-4 regulates mitochondrial UPR-mediated innate immunity and lifespan extension.
Elife 2019 8
[ PubMed ID = 30642431 ] [ RRC reference ]

Deng P, Uma Naresh N, Du Y, Lamech LT, Yu J, Zhu LJ, Pukkila-Worley R, Haynes CM.
Mitochondrial UPR repression during Pseudomonas aeruginosa infection requires the bZIP protein ZIP-3.
Proc Natl Acad Sci U S A 2019 116(13) 6146-6151
[ PubMed ID = 30850535 ] [ RRC reference ]

Shao LW, Niu R, Liu Y.
Neuropeptide signals cell non-autonomous mitochondrial unfolded protein response.
Cell Res 2016 26(11) 1182-1196
[ PubMed ID = 27767096 ] [ RRC reference ]

Peña S, Sherman T, Brookes PS, Nehrke K.
The Mitochondrial Unfolded Protein Response Protects against Anoxia in Caenorhabditis elegans.
PLoS One 2016 11(7) e0159989
[ PubMed ID = 27459203 ] [ RRC reference ]

Fiorese CJ, Schulz AM, Lin YF, Rosin N, Pellegrino MW, Haynes CM.
The Transcription Factor ATF5 Mediates a Mammalian Mitochondrial UPR.
Curr Biol 2016 26(15) 2037-2043
[ PubMed ID = 27426517 ] [ RRC reference ]

Munkácsy E, Khan MH, Lane RK, Borror MB, Park JH, Bokov AF, Fisher AL, Link CD, Rea SL.
DLK-1, SEK-3 and PMK-3 Are Required for the Life Extension Induced by Mitochondrial Bioenergetic Disruption in C. elegans.
PLoS Genet 2016 12(7) e1006133
[ PubMed ID = 27420916 ] [ RRC reference ]

Oks O, Lewin S, Goncalves IL, Sapir A.
The UPR^mt Protects Caenorhabditis elegans from Mitochondrial Dysfunction by Upregulating Specific Enzymes of the Mevalonate Pathway.
Genetics 2018 209(2) 457-473
[ PubMed ID = 29599115 ] [ RRC reference ]

Labbadia J, Brielmann RM, Neto MF, Lin YF, Haynes CM, Morimoto RI.
Mitochondrial Stress Restores the Heat Shock Response and Prevents Proteostasis Collapse during Aging.
Cell Rep 2017 21(6) 1481-1494
[ PubMed ID = 29117555 ] [ RRC reference ]

Cai H, Rasulova M, Vandemeulebroucke L, Meagher L, Vlaeminck C, Dhondt I, Braeckman BP.
Life-Span Extension by Axenic Dietary Restriction Is Independent of the Mitochondrial Unfolded Protein Response and Mitohormesis in Caenorhabditis elegans.
J Gerontol A Biol Sci Med Sci 2017 72(10) 1311-1318
[ PubMed ID = 28329170 ] [ RRC reference ]

Gitschlag BL, Kirby CS, Samuels DC, Gangula RD, Mallal SA, Patel MR.
Homeostatic Responses Regulate Selfish Mitochondrial Genome Dynamics in C. elegans.
Cell Metab 2016 24(1) 91-103
[ PubMed ID = 27411011 ] [ RRC reference ]

Haeussler S, Köhler F, Witting M, Premm MF, Rolland SG, Fischer C, Chauve L, Casanueva O, Conradt B.
Autophagy compensates for defects in mitochondrial dynamics.
PLoS Genet 2020 16(3) e1008638
[ PubMed ID = 32191694 ] [ RRC reference ]

Govindan JA, Jayamani E, Ruvkun G.
ROS-based lethality of Caenorhabditis elegans mitochondrial electron transport mutants grown on Escherichia coli siderophore iron release mutants.
Proc Natl Acad Sci U S A 2019 116(43) 21651-21658
[ PubMed ID = 31591219 ] [ RRC reference ]

Baker BM, Nargund AM, Sun T, Haynes CM.
Protective coupling of mitochondrial function and protein synthesis via the eIF2α kinase GCN-2.
PLoS Genet 2012 8(6) e1002760
[ PubMed ID = 22719267 ] [ RRC reference ]