Mutants (Isolated)

tm4525

Allele Name

tm4525

Sequence Name

ZC376.7

CGC Name

atfs-1

Worm Base

Allele Name

tm4525

CGC Name

atfs-1

Sequence

ZC376.7

Phenotype

homozygous viable.

Mutation site

25767/25768-GAAAAAT-26199/26200 (432 bp deletion + 7 bp insertion)

Chromosome

Putative gene structure

join(25621..25716, 25771..25841, 25891..26266, 27353..27424, 27477..27557, 27691..28343, 28442..28559)

Map position

6.2

Balancer

Map position of balancer

Sequence of primers

IntRev:TCCCGTACCATATTATCTCC,ExtRev:GTCGGCAATGCGAAAAAGAT,IntFwd:ATCCCCATAATGGTTCGCTG,ExtFwd:CACTGCCAATGTGAGTCATG

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Zhou B, Kreuzer J, Kumsta C, Wu L, Kamer KJ, Cedillo L, Zhang Y, Li S, Kacergis MC, Webster CM, Fejes-Toth G, Naray-Fejes-Toth A, Das S, Hansen M, Haas W, Soukas AA.
Mitochondrial Permeability Uncouples Elevated Autophagy and Lifespan Extension.
Cell 2019 177(2) 299-314.e16
[ PubMed ID = 30929899 ] [ RRC reference ]

Dimos BA, Mahmud SA, Fuess LE, Mydlarz LD, Pellegrino MW.
Uncovering a mitochondrial unfolded protein response in corals and its role in adapting to a changing world.
Proc Biol Sci 2019 286(1905) 20190470
[ PubMed ID = 31238849 ] [ RRC reference ]

Rolland SG, Schneid S, Schwarz M, Rackles E, Fischer C, Haeussler S, Regmi SG, Yeroslaviz A, Habermann B, Mokranjac D, Lambie E, Conradt B.
Compromised Mitochondrial Protein Import Acts as a Signal for UPR^mt.
Cell Rep 2019 28(7) 1659-1669.e5
[ PubMed ID = 31412237 ] [ RRC reference ]

Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, Machiela E, Schaar CE, DeJonge H, Blackwell TK, Van Raamsdonk JM.
Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways.
BMC Biol 2018 16(1) 147
[ PubMed ID = 30563508 ] [ RRC reference ]

Solis GM, Kardakaris R, Valentine ER, Bar-Peled L, Chen AL, Blewett MM, McCormick MA, Williamson JR, Kennedy B, Cravatt BF, Petrascheck M.
Translation attenuation by minocycline enhances longevity and proteostasis in old post-stress-responsive organisms.
Elife 2018 7
[ PubMed ID = 30479271 ] [ RRC reference ]

Gao K, Li Y, Hu S, Liu Y.
SUMO peptidase ULP-4 regulates mitochondrial UPR-mediated innate immunity and lifespan extension.
Elife 2019 8
[ PubMed ID = 30642431 ] [ RRC reference ]

Deng P, Uma Naresh N, Du Y, Lamech LT, Yu J, Zhu LJ, Pukkila-Worley R, Haynes CM.
Mitochondrial UPR repression during Pseudomonas aeruginosa infection requires the bZIP protein ZIP-3.
Proc Natl Acad Sci U S A 2019 116(13) 6146-6151
[ PubMed ID = 30850535 ] [ RRC reference ]

Shao LW, Niu R, Liu Y.
Neuropeptide signals cell non-autonomous mitochondrial unfolded protein response.
Cell Res 2016 26(11) 1182-1196
[ PubMed ID = 27767096 ] [ RRC reference ]

Peña S, Sherman T, Brookes PS, Nehrke K.
The Mitochondrial Unfolded Protein Response Protects against Anoxia in Caenorhabditis elegans.
PLoS One 2016 11(7) e0159989
[ PubMed ID = 27459203 ] [ RRC reference ]

Fiorese CJ, Schulz AM, Lin YF, Rosin N, Pellegrino MW, Haynes CM.
The Transcription Factor ATF5 Mediates a Mammalian Mitochondrial UPR.
Curr Biol 2016 26(15) 2037-2043
[ PubMed ID = 27426517 ] [ RRC reference ]

Munkácsy E, Khan MH, Lane RK, Borror MB, Park JH, Bokov AF, Fisher AL, Link CD, Rea SL.
DLK-1, SEK-3 and PMK-3 Are Required for the Life Extension Induced by Mitochondrial Bioenergetic Disruption in C. elegans.
PLoS Genet 2016 12(7) e1006133
[ PubMed ID = 27420916 ] [ RRC reference ]

Oks O, Lewin S, Goncalves IL, Sapir A.
The UPR^mt Protects Caenorhabditis elegans from Mitochondrial Dysfunction by Upregulating Specific Enzymes of the Mevalonate Pathway.
Genetics 2018 209(2) 457-473
[ PubMed ID = 29599115 ] [ RRC reference ]

Labbadia J, Brielmann RM, Neto MF, Lin YF, Haynes CM, Morimoto RI.
Mitochondrial Stress Restores the Heat Shock Response and Prevents Proteostasis Collapse during Aging.
Cell Rep 2017 21(6) 1481-1494
[ PubMed ID = 29117555 ] [ RRC reference ]

Cai H, Rasulova M, Vandemeulebroucke L, Meagher L, Vlaeminck C, Dhondt I, Braeckman BP.
Life-Span Extension by Axenic Dietary Restriction Is Independent of the Mitochondrial Unfolded Protein Response and Mitohormesis in Caenorhabditis elegans.
J Gerontol A Biol Sci Med Sci 2017 72(10) 1311-1318
[ PubMed ID = 28329170 ] [ RRC reference ]

Haeussler S, Köhler F, Witting M, Premm MF, Rolland SG, Fischer C, Chauve L, Casanueva O, Conradt B.
Autophagy compensates for defects in mitochondrial dynamics.
PLoS Genet 2020 16(3) e1008638
[ PubMed ID = 32191694 ] [ RRC reference ]

Govindan JA, Jayamani E, Ruvkun G.
ROS-based lethality of Caenorhabditis elegans mitochondrial electron transport mutants grown on Escherichia coli siderophore iron release mutants.
Proc Natl Acad Sci U S A 2019 116(43) 21651-21658
[ PubMed ID = 31591219 ] [ RRC reference ]

Gitschlag BL, Kirby CS, Samuels DC, Gangula RD, Mallal SA, Patel MR.
Homeostatic Responses Regulate Selfish Mitochondrial Genome Dynamics in C. elegans.
Cell Metab 2016 24(1) 91-103
[ PubMed ID = 27411011 ] [ RRC reference ]

Baker BM, Nargund AM, Sun T, Haynes CM.
Protective coupling of mitochondrial function and protein synthesis via the eIF2α kinase GCN-2.
PLoS Genet 2012 8(6) e1002760
[ PubMed ID = 22719267 ] [ RRC reference ]

Rainbolt TK, Atanassova N, Genereux JC, Wiseman RL.
Stress-regulated translational attenuation adapts mitochondrial protein import through Tim17A degradation.
Cell Metab 2013 18(6) 908-19
[ PubMed ID = 24315374 ] [ RRC reference ]

Liu Y, Samuel BS, Breen PC, Ruvkun G.
Caenorhabditis elegans pathways that surveil and defend mitochondria.
Nature 2014 508(7496) 406-10
[ PubMed ID = 24695221 ] [ RRC reference ]