Mutants (Isolated)

tm4525

Allele Nametm4525
Allele TypeNormal
Sequence NameZC376.7
Gene Nameatfs-1
Worm BaseAllele Name tm4525
Gene Name atfs-1
Sequence ZC376.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25767/25768-GAAAAAT-26199/26200 (432 bp deletion + 7 bp insertion)
ChromosomeV
Putative gene structurejoin(25621..25716, 25771..25841, 25891..26266, 27353..27424, 27477..27557, 27691..28343, 28442..28559)
Map position6.2
Balancer
Map position of balancer
Sequence of primersIntRev:TCCCGTACCATATTATCTCC,ExtRev:GTCGGCAATGCGAAAAAGAT,IntFwd:ATCCCCATAATGGTTCGCTG,ExtFwd:CACTGCCAATGTGAGTCATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Liu Y, Li Q, Tian G, Zhou X, Chen P, Chen B, Shan Z, Qi B.
Neuronal PRDX-2-Mediated ROS Signaling Regulates Food Digestion via peripheral UPRmt Activation.
Nat Commun 2024 15(1) 10582 
[ PubMed ID = 39632952 ] [ RRC reference ]

Zhou L, Jiang L, Li L, Ma C, Xia P, Ding W, Liu Y.
A germline-to-soma signal triggers an age-related decline of mitochondrial stress response.
Nat Commun 2024 15(1) 8723 
[ PubMed ID = 39379393 ] [ RRC reference ]

Charmpilas N, Sotiriou A, Axarlis K, Tavernarakis N, Hoppe T.
Reproductive regulation of the mitochondrial stress response in Caenorhabditis elegans.
Cell Rep 2024 43(6) 114336 
[ PubMed ID = 38852157 ] [ RRC reference ]

Tataridas-Pallas N, Aman Y, Williams R, Chapman H, Cheng KJH, Gomez-Paredes C, Bates GP, Labbadia J.
Mitochondrial clearance and increased HSF-1 activity are coupled to promote longevity in fasted Caenorhabditis elegans.
iScience 2024 27(6) 109834 
[ PubMed ID = 38784016 ] [ RRC reference ]

Kim E, Annibal A, Lee Y, Park HH, Ham S, Jeong DE, Kim Y, Park S, Kwon S, Jung Y, Park J, Kim SS, Antebi A, Lee SV.
Mitochondrial aconitase suppresses immunity by modulating oxaloacetate and the mitochondrial unfolded protein response.
Nat Commun 2023 14(1) 3716 
[ PubMed ID = 37349299 ] [ RRC reference ]

Dai CY, Ng CC, Hung GCC, Kirmes I, Hughes LA, Du Y, Brosnan CA, Ahier A, Hahn A, Haynes CM, Rackham O, Filipovska A, Zuryn S.
ATFS-1 counteracts mitochondrial DNA damage by promoting repair over transcription.
Nat Cell Biol 2023 25(8) 1111-1120 
[ PubMed ID = 37460695 ] [ RRC reference ]

Sladowska M, Turek M, Kim MJ, Drabikowski K, Mussulini BHM, Mohanraj K, Serwa RA, Topf U, Chacinska A.
Proteasome activity contributes to pro-survival response upon mild mitochondrial stress in Caenorhabditis elegans.
PLoS Biol 2021 19(7) e3001302 
[ PubMed ID = 34252079 ] [ RRC reference ]

Lionaki E, Gkikas I, Daskalaki I, Ioannidi MK, Klapa MI, Tavernarakis N.
Mitochondrial protein import determines lifespan through metabolic reprogramming and de novo serine biosynthesis.
Nat Commun 2022 13(1) 651 
[ PubMed ID = 35115503 ] [ RRC reference ]

Angeli S, Foulger A, Chamoli M, Peiris TH, Gerencser A, Shahmirzadi AA, Andersen J, Lithgow G.
The mitochondrial permeability transition pore activates the mitochondrial unfolded protein response and promotes aging.
Elife 2021 10  
[ PubMed ID = 34467850 ] [ RRC reference ]

Littlejohn NK, Seban N, Liu CC, Srinivasan S.
A feedback loop governs the relationship between lipid metabolism and longevity.
Elife 2020 9  
[ PubMed ID = 33078707 ] [ RRC reference ]

Amin MR, Mahmud SA, Dowgielewicz JL, Sapkota M, Pellegrino MW.
A novel gene-diet interaction promotes organismal lifespan and host protection during infection via the mitochondrial UPR.
PLoS Genet 2020 16(12) e1009234 
[ PubMed ID = 33338044 ] [ RRC reference ]

Zhou B, Kreuzer J, Kumsta C, Wu L, Kamer KJ, Cedillo L, Zhang Y, Li S, Kacergis MC, Webster CM, Fejes-Toth G, Naray-Fejes-Toth A, Das S, Hansen M, Haas W, Soukas AA.
Mitochondrial Permeability Uncouples Elevated Autophagy and Lifespan Extension.
Cell 2019 177(2) 299-314.e16 
[ PubMed ID = 30929899 ] [ RRC reference ]

Rolland SG, Schneid S, Schwarz M, Rackles E, Fischer C, Haeussler S, Regmi SG, Yeroslaviz A, Habermann B, Mokranjac D, Lambie E, Conradt B.
Compromised Mitochondrial Protein Import Acts as a Signal for UPRmt.
Cell Rep 2019 28(7) 1659-1669.e5 
[ PubMed ID = 31412237 ] [ RRC reference ]

Haeussler S, Köhler F, Witting M, Premm MF, Rolland SG, Fischer C, Chauve L, Casanueva O, Conradt B.
Autophagy compensates for defects in mitochondrial dynamics.
PLoS Genet 2020 16(3) e1008638 
[ PubMed ID = 32191694 ] [ RRC reference ]

Govindan JA, Jayamani E, Ruvkun G.
ROS-based lethality of Caenorhabditis elegans mitochondrial electron transport mutants grown on Escherichia coli siderophore iron release mutants.
Proc Natl Acad Sci U S A 2019 116(43) 21651-21658 
[ PubMed ID = 31591219 ] [ RRC reference ]

Dimos BA, Mahmud SA, Fuess LE, Mydlarz LD, Pellegrino MW.
Uncovering a mitochondrial unfolded protein response in corals and its role in adapting to a changing world.
Proc Biol Sci 2019 286(1905) 20190470 
[ PubMed ID = 31238849 ] [ RRC reference ]

Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, Machiela E, Schaar CE, DeJonge H, Blackwell TK, Van Raamsdonk JM.
Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways.
BMC Biol 2018 16(1) 147 
[ PubMed ID = 30563508 ] [ RRC reference ]

Solis GM, Kardakaris R, Valentine ER, Bar-Peled L, Chen AL, Blewett MM, McCormick MA, Williamson JR, Kennedy B, Cravatt BF, Petrascheck M.
Translation attenuation by minocycline enhances longevity and proteostasis in old post-stress-responsive organisms.
Elife 2018 7  
[ PubMed ID = 30479271 ] [ RRC reference ]

Gao K, Li Y, Hu S, Liu Y.
SUMO peptidase ULP-4 regulates mitochondrial UPR-mediated innate immunity and lifespan extension.
Elife 2019 8  
[ PubMed ID = 30642431 ] [ RRC reference ]

Deng P, Uma Naresh N, Du Y, Lamech LT, Yu J, Zhu LJ, Pukkila-Worley R, Haynes CM.
Mitochondrial UPR repression during Pseudomonas aeruginosa infection requires the bZIP protein ZIP-3.
Proc Natl Acad Sci U S A 2019 116(13) 6146-6151 
[ PubMed ID = 30850535 ] [ RRC reference ]