Mutants (Isolated)

tm4516

Allele Nametm4516
Sequence NameW03F11.2
CGC Namegcy-17
Worm BaseAllele Name tm4516
CGC Name gcy-17
Sequence W03F11.2
Phenotypehomozygous viable.
Mutation site70336/70337-70663/70664 (327 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(63518..63735, 63794..63892, 64466..64640, 64861..65053, 65782..66575, 66722..67108, 67165..67275, 68440..68518, 68564..69033, 70285..70407, 70458..70576, 70631..70756, 71345..71596, 71650..71759, 73012..73178, 73339..73356))
Map position-10.79
Balancer
Map position of balancer
Sequence of primersExtFwd:CGGCTACCCAAAGACTCTAG,IntFwd:ACCCACCGACGAATACTCCT,ExtRev:CCAGTTCCCAGGAGGTTCCA,IntRev:CCTCGTTCCAGATTCCTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC.
CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration.
Ann Neurol 2013 74(1) 39-52 
[ PubMed ID = 23424178 ] [ RRC reference ]

Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(1) 254-9 
[ PubMed ID = 21173231 ] [ RRC reference ]