| Allele Name | tm4516 |
| Sequence Name | W03F11.2 |
| CGC Name | gcy-17 |
| Worm Base | Allele Name |
tm4516
|
| CGC Name |
gcy-17
|
| Sequence |
W03F11.2
|
| Phenotype | homozygous viable. |
| Mutation site | 70336/70337-70663/70664 (327 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(63518..63735, 63794..63892, 64466..64640, 64861..65053, 65782..66575, 66722..67108, 67165..67275, 68440..68518, 68564..69033, 70285..70407, 70458..70576, 70631..70756, 71345..71596, 71650..71759, 73012..73178, 73339..73356)) |
| Map position | -10.79 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CGGCTACCCAAAGACTCTAG,IntFwd:ACCCACCGACGAATACTCCT,ExtRev:CCAGTTCCCAGGAGGTTCCA,IntRev:CCTCGTTCCAGATTCCTTTG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC.
CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration.
Ann. Neurol. 2013 74(1) 39-52
[ PubMed ID = 23424178 ]
[ RRC reference ]
|
Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(1) 254-9
[ PubMed ID = 21173231 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.