Mutants (Isolated)

tm4475

Allele Nametm4475
Sequence NameT24A11.1
CGC Namemtm-3
Worm BaseAllele Name tm4475
CGC Name mtm-3
Sequence T24A11.1
PhenotypeLet or Ste.
Mutation site16434/16435-TTATTATAAGTT-16836/16837 (402 bp deletion + 12 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(10788..11013, 12234..12991, 13719..14401, 15262..15590, 16120..16580, 16637..16813, 19976..20038, 20093..20212))
Map position-4.25
Balancer
Map position of balancer
Sequence of primersExtFwd:CGAATCCACCACTCCTTGCT,IntFwd:GCTCTGTTCGCAAATGCAGA,ExtRev:GCTCTCACAGGGCAAAGCAA,IntRev:GTCAGTAGGCACCAATTATC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wu Y, Cheng S, Zhao H, Zou W, Yoshina S, Mitani S, Zhang H, Wang X.
PI3P phosphatase activity is required for autophagosome maturation and autolysosome formation.
EMBO Rep 2014 15(9) 973-81 
[ PubMed ID = 25124690 ] [ RRC reference ]

Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev Cell 2016 38(2) 171-85 
[ PubMed ID = 27396362 ] [ RRC reference ]

Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]