| Allele Name | tm446 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | K01A6.2 |
| Gene Name | magi-1 |
| Worm Base | Allele Name |
tm446
|
| Gene Name |
magi-1
|
| Sequence |
K01A6.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. J. Kaplan: wild type movement, nonEgl, nonRic, apparently wild type pattern of GLR-1::GFP. Dr. J. Saterlee: normal brood size, development and movement. Dr. J. Rand: normal thermotaxis. Dr. K. Shen: normal synapse formation as determined by VAMP::YFP localization to presynaptic sites in HSNL. Dr. A. Hajnal: WT localization of LET-23 in the vulval precursor cells. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 9841/9842-10251/10252 (410 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(7453..7517, 8492..8559, 8607..8671, 8848..8914, 9435..9672, 9718..9914, 10311..10430, 15971..16103, 16441..16536, 18407..18545, 18596..18877, 19804..20457, 20507..21388, 21822..21968, 22323..22448) |
| Map position | 5.24 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:AAGCAGGAGACGTAGAGGGT,IntRev:GAGACGAGGACTGTGAGGTA,IntFwd:GGTGGTGGGTACACTGCACG,ExtFwd:CAACAGGTGTGACCGCACTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Stetak A, Hörndli F, Maricq AV, van den Heuvel S, Hajnal A. Neuron-specific regulation of associative learning and memory by MAGI-1 in C. elegans. PLoS One 2009 4(6) e6019
[ PubMed ID = 19551147 ]
[ RRC reference ]
|
Emtage L, Chang H, Tiver R, Rongo C. MAGI-1 modulates AMPA receptor synaptic localization and behavioral plasticity in response to prior experience. PLoS One 2009 4(2) e4613
[ PubMed ID = 19242552 ]
[ RRC reference ]
|
|