Home > Mutants (Isolated) > tm446

Mutants (Isolated)

Allele Name		tm446
Allele Type		Normal
Sequence Name		K01A6.2
Gene Name		magi-1
Worm Base	Allele Name	tm446
	Gene Name	magi-1
	Sequence	K01A6.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. J. Kaplan: wild type movement, nonEgl, nonRic, apparently wild type pattern of GLR-1::GFP. Dr. J. Saterlee: normal brood size, development and movement. Dr. J. Rand: normal thermotaxis. Dr. K. Shen: normal synapse formation as determined by VAMP::YFP localization to presynaptic sites in HSNL. Dr. A. Hajnal: WT localization of LET-23 in the vulval precursor cells.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		9841/9842-10251/10252 (410 bp deletion)
Chromosome		IV
Putative gene structure		join(7453..7517, 8492..8559, 8607..8671, 8848..8914, 9435..9672, 9718..9914, 10311..10430, 15971..16103, 16441..16536, 18407..18545, 18596..18877, 19804..20457, 20507..21388, 21822..21968, 22323..22448)
Map position		5.24
Balancer
Map position of balancer
Sequence of primers		ExtRev:AAGCAGGAGACGTAGAGGGT,IntRev:GAGACGAGGACTGTGAGGTA,IntFwd:GGTGGTGGGTACACTGCACG,ExtFwd:CAACAGGTGTGACCGCACTA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Stetak A, Hörndli F, Maricq AV, van den Heuvel S, Hajnal A. Neuron-specific regulation of associative learning and memory by MAGI-1 in C. elegans. PLoS One 2009 4(6) e6019  [ PubMed ID = 19551147 ] [ RRC reference ] Emtage L, Chang H, Tiver R, Rongo C. MAGI-1 modulates AMPA receptor synaptic localization and behavioral plasticity in response to prior experience. PLoS One 2009 4(2) e4613  [ PubMed ID = 19242552 ] [ RRC reference ]