Mutants (Isolated)

tm4453

Allele Nametm4453
BalanceNot Required
OutCrossNot Accepted
Sequence NameY40D12A.1
Gene NameY40D12A.1
Worm BaseAllele Name tm4453
Gene Name Y40D12A.1
Sequence Y40D12A.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 5643/5644-5933/5934 (290 bp deletion)
ChromosomeIII
Putative gene structurejoin(5232..5321, 5389..5484, 5547..5635, 5684..5776, 5822..6134, 6177..6389, 6432..6634, 6684..6834, 6882..6953, 8918..9013, 9063..9224, 9278..9424, 9474..9656)
Map position-1.04
Balancer
Map position of balancer
Sequence of primersExtFwd:GTCTCCCATGCTCTTCGCGA,IntFwd:CCAGGGTTCATTTACCAGGA,ExtRev:CAGAGCTTCCAGGTCGACTT,IntRev:GGCTTGATCGCTTTGATACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dix TC, Haussmann IU, Brivio S, Nallasivan MP, HadzHiev Y, Müller F, Müller B, Pettitt J, Soller M.
CMTr mediated 2'-O-ribose methylation status of cap-adjacent nucleotides across animals.
RNA 2022 28(10) 1377-1390 
[ PubMed ID = 35970556 ] [ RRC reference ]