分離済み変異体

tm4417

Allele Nametm4417
Allele Type通常株
Sequence NameK04A8.5
Gene Namelipl-4
Worm BaseAllele Name tm4417
Gene Name lipl-4
Sequence K04A8.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17093/17094-TTTTAG-17545/17546 (452 bp deletion + 6 bp insertion)
ChromosomeV
Putative gene structurejoin(16230..16337, 16545..16873, 16917..17067, 17134..17667, 17716..17829)
Map position0.06
Balancer
Map position of balancer
Sequence of primersExtFwd:TGAGCGACGTGGTTATGTGA,IntFwd:GACTGCTTTCTGGGCCTAGT,ExtRev:TATAAACTTGGCTGGCTGCA,IntRev:GGCTGCATTTGTTCCCCAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, Boyko A, Mazer T, Ang S, Khopkar R, Javaheri A, Kumar S, Jiang X, Ory D, Mani K, Matkovich SJ, Kornfeld K, Diwan A.
Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival.
PLoS Biol 2019 17(5) e3000245 
[ PubMed ID = 31086360 ] [ RRC reference ]

Buis A, Bellemin S, Goudeau J, Monnier L, Loiseau N, Guillou H, Aguilaniu H.
Coelomocytes Regulate Starvation-Induced Fat Catabolism and Lifespan Extension through the Lipase LIPL-5 in Caenorhabditis elegans.
Cell Rep 2019 28(4) 1041-1049.e4 
[ PubMed ID = 31340142 ] [ RRC reference ]

Seah NE, de Magalhaes Filho CD, Petrashen AP, Henderson HR, Laguer J, Gonzalez J, Dillin A, Hansen M, Lapierre LR.
Autophagy-mediated longevity is modulated by lipoprotein biogenesis.
Autophagy 2016 12(2) 261-72 
[ PubMed ID = 26671266 ] [ RRC reference ]

Palikaras K, Mari M, Petanidou B, Pasparaki A, Filippidis G, Tavernarakis N.
Ectopic fat deposition contributes to age-associated pathology in Caenorhabditis elegans.
J Lipid Res 2017 58(1) 72-80 
[ PubMed ID = 27884963 ] [ RRC reference ]

O'Rourke EJ, Kuballa P, Xavier R, Ruvkun G.
ω-6 Polyunsaturated fatty acids extend life span through the activation of autophagy.
Genes Dev 2013 27(4) 429-40 
[ PubMed ID = 23392608 ] [ RRC reference ]

Folick A, Oakley HD, Yu Y, Armstrong EH, Kumari M, Sanor L, Moore DD, Ortlund EA, Zechner R, Wang MC.
Aging. Lysosomal signaling molecules regulate longevity in Caenorhabditis elegans.
Science 2015 347(6217) 83-6 
[ PubMed ID = 25554789 ] [ RRC reference ]