Mutants (Isolated)

tm4397

Allele Nametm4397
BalanceNot Required
OutCrossNot Accepted
Sequence NameT04C10.4
Gene Nameatf-5
Worm BaseAllele Name tm4397
Gene Name atf-5
Sequence T04C10.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 959/960-1765/1766 (806 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(450..527, 572..847, 1372..1644))
Map position21.36
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCTCCAACTCGGATACCTG,IntFwd:GATCCTTCAGCTTGCCATTG,ExtRev:GTCATCGCGAACGCTCCTTC,IntRev:GCCACAGCGCCAATTTGTAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kawano T, Kashiwagi M, Kanuka M, Chen CK, Yasugaki S, Hatori S, Miyazaki S, Tanaka K, Fujita H, Nakajima T, Yanagisawa M, Nakagawa Y, Hayashi Y.
ER proteostasis regulators cell-non-autonomously control sleep.
Cell Rep 2023 42(3) 112267 
[ PubMed ID = 36924492 ] [ RRC reference ]

Statzer C, Meng J, Venz R, Bland M, Robida-Stubbs S, Patel K, Petrovic D, Emsley R, Liu P, Morantte I, Haynes C, Mair WB, Longchamp A, Filipovic MR, Blackwell TK, Ewald CY.
ATF-4 and hydrogen sulfide signalling mediate longevity in response to inhibition of translation or mTORC1.
Nat Commun 2022 13(1) 967 
[ PubMed ID = 35181679 ] [ RRC reference ]

Hernández IH, Torres-Peraza J, Santos-Galindo M, Ramos-Morón E, Fernández-Fernández MR, Pérez-Álvarez MJ, Miranda-Vizuete A, Lucas JJ.
The neuroprotective transcription factor ATF5 is decreased and sequestered into polyglutamine inclusions in Huntington's disease.
Acta Neuropathol 2017 134(6) 839-850 
[ PubMed ID = 28861715 ] [ RRC reference ]

Ferraz RC, Camara H, De-Souza EA, Pinto S, Pinca AP, Silva RC, Sato VN, Castilho BA, Mori MA.
IMPACT is a GCN2 inhibitor that limits lifespan in Caenorhabditis elegans.
BMC Biol 2016 14(1) 87 
[ PubMed ID = 27717342 ] [ RRC reference ]

Glover-Cutter KM, Lin S, Blackwell TK.
Integration of the unfolded protein and oxidative stress responses through SKN-1/Nrf.
PLoS Genet 2013 9(9) e1003701 
[ PubMed ID = 24068940 ] [ RRC reference ]