Mutants (Isolated)

tm4397

Allele Nametm4397
Sequence NameT04C10.4
CGC Nameatf-5
Worm BaseAllele Name tm4397
CGC Name atf-5
Sequence T04C10.4
Phenotypehomozygous viable.
Mutation site959/960-1765/1766 (806 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(450..527, 572..847, 1372..1644))
Map position21.36
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCTCCAACTCGGATACCTG,IntFwd:GATCCTTCAGCTTGCCATTG,ExtRev:GTCATCGCGAACGCTCCTTC,IntRev:GCCACAGCGCCAATTTGTAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hernández IH, Torres-Peraza J, Santos-Galindo M, Ramos-Morón E, Fernández-Fernández MR, Pérez-Álvarez MJ, Miranda-Vizuete A, Lucas JJ.
The neuroprotective transcription factor ATF5 is decreased and sequestered into polyglutamine inclusions in Huntington's disease.
Acta Neuropathol. 2017 134(6) 839-850 
[ PubMed ID = 28861715 ] [ RRC reference ]

Glover-Cutter KM, Lin S, Blackwell TK.
Integration of the unfolded protein and oxidative stress responses through SKN-1/Nrf.
PLoS Genet. 2013 9(9) e1003701 
[ PubMed ID = 24068940 ] [ RRC reference ]

Ferraz RC, Camara H, De-Souza EA, Pinto S, Pinca AP, Silva RC, Sato VN, Castilho BA, Mori MA.
IMPACT is a GCN2 inhibitor that limits lifespan in Caenorhabditis elegans.
BMC Biol. 2016 14(1) 87 
[ PubMed ID = 27717342 ] [ RRC reference ]