Home > Mutants (Isolated) > tm4392

Mutants (Isolated)

Allele Name		tm4392
Balance		Completed
OutCross		Not Accepted
Sequence Name		C07G2.2
Gene Name		atf-7
Worm Base	Allele Name	tm4392 (x1)
	Gene Name	atf-7
	Sequence	C07G2.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Let or Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		12407/12408-12772/12773 (365 bp deletion)
Chromosome		III
Putative gene structure		complement(join(10952..11062, 11298..11405, 11456..11747, 11804..12207, 12325..12738, 17137..17181))
Map position		-3.15
Balancer		qC1[nIs281]
Map position of balancer
Sequence of primers		IntRev:GTTATGCCAACGTCGATGAC,ExtRev:CCGCACTCATAAGTCCGATG,IntFwd:TACGATATCTCACAGCCGCA,ExtFwd:CCTTTCGAGTTCCCGTCGCA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Tsai Y, Lin YC, Lee YH. Octopamine-MAPK-SKN-1 signaling suppresses mating-induced oxidative stress in Caenorhabditis elegans gonads to protect fertility. iScience 2023 26(3) 106162  [ PubMed ID = 36876134 ] [ RRC reference ] Liu M, Li N, Shan S, Shi Y, Zhu Y, Lu W. Acanthopanax senticosus Polysaccharide Enhances the Pathogen Resistance of Radiation-Damaged Caenorhabditis elegans through Intestinal p38 MAPK-SKN-1/ATF-7 Pathway and Stress Response. Int J Mol Sci 2022 23(9)   [ PubMed ID = 35563423 ] [ RRC reference ] Li W, Wang D, Wang D. Regulation of the Response of Caenorhabditis elegans to Simulated Microgravity by p38 Mitogen-Activated Protein Kinase Signaling. Sci Rep 2018 8(1) 857  [ PubMed ID = 29339777 ] [ RRC reference ]