Mutants (Isolated)

tm4392

Allele Nametm4392
Sequence NameC07G2.2
CGC Nameatf-7
Worm BaseAllele Name tm4392
CGC Name atf-7
Sequence C07G2.2
PhenotypeLet or Ste.
Mutation site12407/12408-12772/12773 (365 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(10952..11062, 11298..11405, 11456..11747, 11804..12207, 12325..12738, 17137..17181))
Map position-3.15
Balancer
Map position of balancer
Sequence of primersIntRev:GTTATGCCAACGTCGATGAC,ExtRev:CCGCACTCATAAGTCCGATG,IntFwd:TACGATATCTCACAGCCGCA,ExtFwd:CCTTTCGAGTTCCCGTCGCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Li W, Wang D, Wang D.
Regulation of the Response of Caenorhabditis elegans to Simulated Microgravity by p38 Mitogen-Activated Protein Kinase Signaling.
Sci Rep 2018 8(1) 857 
[ PubMed ID = 29339777 ] [ RRC reference ]