Mutants (Isolated)

tm4314

Allele Nametm4314
Allele TypeNormal
Sequence NameF01D4.3
Gene NameF01D4.3
Worm BaseAllele Name tm4314
Gene Name F01D4.3
Sequence F01D4.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22421/22422-23720/23721 (1299 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(21786..22104, 22159..22335, 22380..22948, 22995..23189))
Map position4.6
Balancer
Map position of balancer
Sequence of primersIntRev:GTGTCACGTTGCAAGCCAAG,IntFwd:GACTCACCGATGAATACAGT,ExtRev:CCATATGGGCTCTGACCATA,ExtFwd:TACGAGCAGCAATGTCACTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Timbers TA, Garland SJ, Mohan S, Flibotte S, Edgley M, Muncaster Q, Au V, Li-Leger E, Rosell FI, Cai J, Rademakers S, Jansen G, Moerman DG, Leroux MR.
Accelerating Gene Discovery by Phenotyping Whole-Genome Sequenced Multi-mutation Strains and Using the Sequence Kernel Association Test (SKAT).
PLoS Genet 2016 12(8) e1006235 
[ PubMed ID = 27508411 ] [ RRC reference ]