Mutants (Isolated)

tm4291

Allele Nametm4291
BalanceNot Required
OutCrossNot Accepted
Sequence NameF09E10.3
Gene Namedhs-25
Worm BaseAllele Name tm4291
Gene Name dhs-25
Sequence F09E10.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1113/1114-1521/1522 (408 bp deletion)
ChromosomeX
Putative gene structurejoin(151..190, 771..1012, 1136..1210, 1554..1727, 2490..2705)
Map position-18.04
Balancer
Map position of balancer
Sequence of primersExtFwd:GATCAAACCGAAACCCCCAG,IntFwd:ACGGTAGCTTACGCTATATG,ExtRev:CTATTAAGTTCAGGCCTCAG,IntRev:AGTGCAACAGAGGTGTGCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pensotti R, Sciandrone B, Bovio F, Schröter L, Maglioni S, Thewes L, Forcella ME, Rossi A, Fusi PA, Berndt C, Ventura N, Regonesi ME.
Redox homeostasis in ferroptosis and aging: a causal role for fard-1 and dhs-25 in Caenorhabditis elegans.
Redox Biol 2025 88 103912 
[ PubMed ID = 41223747 ] [ RRC reference ]