Mutants (Isolated)

tm4241

Allele Name

tm4241

Balance

Not Required

OutCross

Not Accepted

Sequence Name

T19E7.2

Gene Name

skn-1

Worm Base

Allele Name

tm4241

Gene Name

skn-1

Sequence

T19E7.2

Phenotype

homozygous viable.

Mutation site

1173/1174-1467/1468 (294 bp deletion)

Chromosome

Putative gene structure

complement(join(36..112, 165..532, 686..944, 1621..1773, 1827..2148, 3455..3877)), complement(join(36..112, 165..532, 686..944, 1139..1367))

Map position

2.02

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CGTTTGAGTCTGCTGTTGAC,IntFwd:GACAGTGGAGTCTGACCAGT,ExtRev:CGAGATGCAAGAGATGCGTG,IntRev:GCGTGATTCCTGCAATCAAG

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Yu J, Gao X, Shi H, Zhang L, Nie W, Zhang R, Fang M, Liu Y, Yan Y, Fan B, Wu C, Huang C, Fan S.
Activation of Nuclear Receptor CAR: A Pathway to Delay Aging through Enhanced Capacity for Xenobiotic Resistance.
Adv Sci (Weinh) 2025 12(12) e2416823
[ PubMed ID = 39887667 ] [ RRC reference ]

Gao X, Yu J, Li Y, Shi H, Zhang L, Fang M, Liu Y, Huang C, Fan S.
27-Hydroxymangiferolic Acid Extends Lifespan and Improves Neurodegeneration in Caenorhabditis elegans by Activating Nuclear Receptors.
Molecules 2025 30(5)
[ PubMed ID = 40076235 ] [ RRC reference ]

Yu J, Gao X, Zhang L, Shi H, Yan Y, Han Y, Wu C, Liu Y, Fang M, Huang C, Fan S.
Magnolol extends lifespan and improves age-related neurodegeneration in Caenorhabditis elegans via increase of stress resistance.
Sci Rep 2024 14(1) 3158
[ PubMed ID = 38326350 ] [ RRC reference ]

Somuah-Asante S, Sakamoto K.
Stress Buffering and Longevity Effects of Amber Extract on Caenorhabditis elegans (C. elegans).
Molecules 2022 27(12)
[ PubMed ID = 35744983 ] [ RRC reference ]

Tataridas-Pallas N, Thompson MA, Howard A, Brown I, Ezcurra M, Wu Z, Silva IG, Saunter CD, Kuerten T, Weinkove D, Blackwell TK, Tullet JMA.
Neuronal SKN-1B modulates nutritional signalling pathways and mitochondrial networks to control satiety.
PLoS Genet 2021 17(3) e1009358
[ PubMed ID = 33661901 ] [ RRC reference ]

Sugawara T, Sakamoto K.
Quercetin enhances motility in aged and heat-stressed Caenorhabditis elegans nematodes by modulating both HSF-1 activity, and insulin-like and p38-MAPK signalling.
PLoS One 2020 15(9) e0238528
[ PubMed ID = 32881908 ] [ RRC reference ]

Shintani T, Sakoguchi H, Yoshihara A, Izumori K, Sato M.
d-Allulose, a stereoisomer of d-fructose, extends Caenorhabditis elegans lifespan through a dietary restriction mechanism: A new candidate dietary restriction mimetic.
Biochem Biophys Res Commun 2017 493(4) 1528-1533
[ PubMed ID = 28965946 ] [ RRC reference ]