Mutants (Isolated)

tm4241

Allele Nametm4241
Sequence NameT19E7.2
CGC Nameskn-1
Worm BaseAllele Name tm4241
CGC Name skn-1
Sequence T19E7.2
Phenotypehomozygous viable.
Mutation site1173/1174-1467/1468 (294 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(36..112, 165..532, 686..944, 1621..1773, 1827..2148, 3455..3877)), complement(join(36..112, 165..532, 686..944, 1139..1367))
Map position2.02
Balancer
Map position of balancer
Sequence of primersExtFwd:CGTTTGAGTCTGCTGTTGAC,IntFwd:GACAGTGGAGTCTGACCAGT,ExtRev:CGAGATGCAAGAGATGCGTG,IntRev:GCGTGATTCCTGCAATCAAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Shintani T, Sakoguchi H, Yoshihara A, Izumori K, Sato M.
d-Allulose, a stereoisomer of d-fructose, extends Caenorhabditis elegans lifespan through a dietary restriction mechanism: A new candidate dietary restriction mimetic.
Biochem. Biophys. Res. Commun. 2017 493(4) 1528-1533 
[ PubMed ID = 28965946 ] [ RRC reference ]