Mutants (Isolated)

tm4225

Allele Nametm4225
Sequence NameY38C1AA.11
CGC Nameprdx-6
Worm BaseAllele Name tm4225
CGC Name prdx-6
Sequence Y38C1AA.11
Phenotypehomozygous viable.
Mutation site72645/72646-TTTT-73087/73088 (442 bp deletion + 4 bp insertion)
ChromosomeIV
Putative gene structurejoin(71630..71715, 72525..72905, 73604..73832)
Map position-26.75
Balancer
Map position of balancer
Sequence of primersIntFwd:GGCTGATGCTGTTCAGTCAC,ExtFwd:AGATGGCTGATGCTGTTCAG,IntRev:CCACTGGGTTCTGGCCTTTC,ExtRev:GTCCCATTACCACTGGGTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bhatla N, Horvitz HR.
Light and hydrogen peroxide inhibit C. elegans Feeding through gustatory receptor orthologs and pharyngeal neurons.
Neuron 2015 85(4) 804-18 
[ PubMed ID = 25640076 ] [ RRC reference ]